ID: 1174548683

View in Genome Browser
Species Human (GRCh38)
Location 20:51345416-51345438
Sequence TGCCATTCCCTGAGTGGGTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1174548683_1174548690 16 Left 1174548683 20:51345416-51345438 CCCAACCCACTCAGGGAATGGCA No data
Right 1174548690 20:51345455-51345477 TATTGGAACACTGCCCTCCTCGG No data
1174548683_1174548691 19 Left 1174548683 20:51345416-51345438 CCCAACCCACTCAGGGAATGGCA No data
Right 1174548691 20:51345458-51345480 TGGAACACTGCCCTCCTCGGAGG No data
1174548683_1174548688 -1 Left 1174548683 20:51345416-51345438 CCCAACCCACTCAGGGAATGGCA No data
Right 1174548688 20:51345438-51345460 ATGGAGTCCAGAATTGCTATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1174548683 Original CRISPR TGCCATTCCCTGAGTGGGTT GGG (reversed) Intergenic
No off target data available for this crispr