ID: 1174552595

View in Genome Browser
Species Human (GRCh38)
Location 20:51372704-51372726
Sequence GACAGCTGTACCTACTTAGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1174552589_1174552595 -7 Left 1174552589 20:51372688-51372710 CCAAGCACAGAAGCCCGACAGCT No data
Right 1174552595 20:51372704-51372726 GACAGCTGTACCTACTTAGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1174552595 Original CRISPR GACAGCTGTACCTACTTAGG GGG Intergenic
No off target data available for this crispr