ID: 1174553270

View in Genome Browser
Species Human (GRCh38)
Location 20:51376469-51376491
Sequence CCCTCTGTAAAGATGGAGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 13 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1174553270_1174553289 26 Left 1174553270 20:51376469-51376491 CCCAGCTCCATCTTTACAGAGGG No data
Right 1174553289 20:51376518-51376540 GGGCCGGAGAGGGACTGAGAGGG No data
1174553270_1174553287 16 Left 1174553270 20:51376469-51376491 CCCAGCTCCATCTTTACAGAGGG No data
Right 1174553287 20:51376508-51376530 ATGAGGGGAGGGGCCGGAGAGGG No data
1174553270_1174553290 27 Left 1174553270 20:51376469-51376491 CCCAGCTCCATCTTTACAGAGGG No data
Right 1174553290 20:51376519-51376541 GGCCGGAGAGGGACTGAGAGGGG No data
1174553270_1174553278 -8 Left 1174553270 20:51376469-51376491 CCCAGCTCCATCTTTACAGAGGG No data
Right 1174553278 20:51376484-51376506 ACAGAGGGTAGAGGGGCAGGAGG No data
1174553270_1174553281 1 Left 1174553270 20:51376469-51376491 CCCAGCTCCATCTTTACAGAGGG No data
Right 1174553281 20:51376493-51376515 AGAGGGGCAGGAGGCATGAGGGG No data
1174553270_1174553280 0 Left 1174553270 20:51376469-51376491 CCCAGCTCCATCTTTACAGAGGG No data
Right 1174553280 20:51376492-51376514 TAGAGGGGCAGGAGGCATGAGGG No data
1174553270_1174553279 -1 Left 1174553270 20:51376469-51376491 CCCAGCTCCATCTTTACAGAGGG No data
Right 1174553279 20:51376491-51376513 GTAGAGGGGCAGGAGGCATGAGG No data
1174553270_1174553288 25 Left 1174553270 20:51376469-51376491 CCCAGCTCCATCTTTACAGAGGG No data
Right 1174553288 20:51376517-51376539 GGGGCCGGAGAGGGACTGAGAGG No data
1174553270_1174553283 5 Left 1174553270 20:51376469-51376491 CCCAGCTCCATCTTTACAGAGGG No data
Right 1174553283 20:51376497-51376519 GGGCAGGAGGCATGAGGGGAGGG No data
1174553270_1174553284 6 Left 1174553270 20:51376469-51376491 CCCAGCTCCATCTTTACAGAGGG No data
Right 1174553284 20:51376498-51376520 GGCAGGAGGCATGAGGGGAGGGG No data
1174553270_1174553282 4 Left 1174553270 20:51376469-51376491 CCCAGCTCCATCTTTACAGAGGG No data
Right 1174553282 20:51376496-51376518 GGGGCAGGAGGCATGAGGGGAGG No data
1174553270_1174553286 15 Left 1174553270 20:51376469-51376491 CCCAGCTCCATCTTTACAGAGGG No data
Right 1174553286 20:51376507-51376529 CATGAGGGGAGGGGCCGGAGAGG No data
1174553270_1174553285 10 Left 1174553270 20:51376469-51376491 CCCAGCTCCATCTTTACAGAGGG No data
Right 1174553285 20:51376502-51376524 GGAGGCATGAGGGGAGGGGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1174553270 Original CRISPR CCCTCTGTAAAGATGGAGCT GGG (reversed) Intergenic
No off target data available for this crispr