ID: 1174556801

View in Genome Browser
Species Human (GRCh38)
Location 20:51401249-51401271
Sequence AACCTCAGCTACCTGGGAGG CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1174556792_1174556801 29 Left 1174556792 20:51401197-51401219 CCGTCTCTACTAAAAATACAAAA No data
Right 1174556801 20:51401249-51401271 AACCTCAGCTACCTGGGAGGCGG No data
1174556791_1174556801 30 Left 1174556791 20:51401196-51401218 CCCGTCTCTACTAAAAATACAAA No data
Right 1174556801 20:51401249-51401271 AACCTCAGCTACCTGGGAGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1174556801 Original CRISPR AACCTCAGCTACCTGGGAGG CGG Intronic