ID: 1174556801 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 20:51401249-51401271 |
Sequence | AACCTCAGCTACCTGGGAGG CGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | Yes |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1174556792_1174556801 | 29 | Left | 1174556792 | 20:51401197-51401219 | CCGTCTCTACTAAAAATACAAAA | No data | ||
Right | 1174556801 | 20:51401249-51401271 | AACCTCAGCTACCTGGGAGGCGG | No data | ||||
1174556791_1174556801 | 30 | Left | 1174556791 | 20:51401196-51401218 | CCCGTCTCTACTAAAAATACAAA | No data | ||
Right | 1174556801 | 20:51401249-51401271 | AACCTCAGCTACCTGGGAGGCGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1174556801 | Original CRISPR | AACCTCAGCTACCTGGGAGG CGG | Intronic | ||