ID: 1174563537

View in Genome Browser
Species Human (GRCh38)
Location 20:51448141-51448163
Sequence CTGTCTGTTCATTTATCACC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1174563537_1174563540 29 Left 1174563537 20:51448141-51448163 CCAGGTGATAAATGAACAGACAG No data
Right 1174563540 20:51448193-51448215 TGCCCCCAAGAAAACAGAGCCGG No data
1174563537_1174563541 30 Left 1174563537 20:51448141-51448163 CCAGGTGATAAATGAACAGACAG No data
Right 1174563541 20:51448194-51448216 GCCCCCAAGAAAACAGAGCCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1174563537 Original CRISPR CTGTCTGTTCATTTATCACC TGG (reversed) Intronic