ID: 1174565032

View in Genome Browser
Species Human (GRCh38)
Location 20:51458361-51458383
Sequence ACCAAGATTGTCTCCAGACA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 323
Summary {0: 1, 1: 9, 2: 30, 3: 65, 4: 218}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1174565029_1174565032 -9 Left 1174565029 20:51458347-51458369 CCCCAGCTGTGACAACCAAGATT 0: 1
1: 0
2: 43
3: 243
4: 733
Right 1174565032 20:51458361-51458383 ACCAAGATTGTCTCCAGACAAGG 0: 1
1: 9
2: 30
3: 65
4: 218
1174565028_1174565032 -8 Left 1174565028 20:51458346-51458368 CCCCCAGCTGTGACAACCAAGAT 0: 1
1: 0
2: 39
3: 165
4: 575
Right 1174565032 20:51458361-51458383 ACCAAGATTGTCTCCAGACAAGG 0: 1
1: 9
2: 30
3: 65
4: 218
1174565024_1174565032 7 Left 1174565024 20:51458331-51458353 CCAGGAGCACCCTACCCCCCAGC 0: 1
1: 0
2: 0
3: 34
4: 440
Right 1174565032 20:51458361-51458383 ACCAAGATTGTCTCCAGACAAGG 0: 1
1: 9
2: 30
3: 65
4: 218
1174565023_1174565032 18 Left 1174565023 20:51458320-51458342 CCTATCAGATGCCAGGAGCACCC 0: 1
1: 11
2: 79
3: 370
4: 965
Right 1174565032 20:51458361-51458383 ACCAAGATTGTCTCCAGACAAGG 0: 1
1: 9
2: 30
3: 65
4: 218
1174565025_1174565032 -2 Left 1174565025 20:51458340-51458362 CCCTACCCCCCAGCTGTGACAAC 0: 1
1: 0
2: 10
3: 71
4: 321
Right 1174565032 20:51458361-51458383 ACCAAGATTGTCTCCAGACAAGG 0: 1
1: 9
2: 30
3: 65
4: 218
1174565027_1174565032 -7 Left 1174565027 20:51458345-51458367 CCCCCCAGCTGTGACAACCAAGA 0: 1
1: 10
2: 79
3: 232
4: 664
Right 1174565032 20:51458361-51458383 ACCAAGATTGTCTCCAGACAAGG 0: 1
1: 9
2: 30
3: 65
4: 218
1174565026_1174565032 -3 Left 1174565026 20:51458341-51458363 CCTACCCCCCAGCTGTGACAACC 0: 1
1: 4
2: 32
3: 166
4: 620
Right 1174565032 20:51458361-51458383 ACCAAGATTGTCTCCAGACAAGG 0: 1
1: 9
2: 30
3: 65
4: 218
1174565030_1174565032 -10 Left 1174565030 20:51458348-51458370 CCCAGCTGTGACAACCAAGATTG 0: 1
1: 2
2: 60
3: 340
4: 807
Right 1174565032 20:51458361-51458383 ACCAAGATTGTCTCCAGACAAGG 0: 1
1: 9
2: 30
3: 65
4: 218
1174565021_1174565032 30 Left 1174565021 20:51458308-51458330 CCTTGGGTTCTACCTATCAGATG 0: 1
1: 1
2: 3
3: 59
4: 413
Right 1174565032 20:51458361-51458383 ACCAAGATTGTCTCCAGACAAGG 0: 1
1: 9
2: 30
3: 65
4: 218

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1174565032 Original CRISPR ACCAAGATTGTCTCCAGACA AGG Intronic
900884885 1:5408103-5408125 ACCAAAAGTGTCTCCAGACATGG + Intergenic
901096129 1:6681763-6681785 ACCAAGAGGGTCTCTAGACAGGG + Intronic
901782827 1:11605349-11605371 TCCAAAAATGTCTCCAGTCATGG + Intergenic
902175442 1:14646688-14646710 AACAAAAATGTCTCCAGACATGG + Intronic
902284797 1:15400547-15400569 ACTAAAATTATGTCCAGACATGG - Intergenic
903078328 1:20788805-20788827 ACCAAGATTGTTTTGAGACAGGG - Intergenic
904989286 1:34578597-34578619 CCCAAGGTTTTCCCCAGACATGG + Intergenic
905751136 1:40465090-40465112 GTCAAAAATGTCTCCAGACATGG + Intergenic
905775795 1:40666301-40666323 ACCAAAAATGTCTCCAGACATGG - Intergenic
909551406 1:76901363-76901385 ACTGAGATTGTCTCCAGCCCAGG + Intronic
910293736 1:85623742-85623764 ACCAAGAATGTGGCCAGGCATGG + Intergenic
910938525 1:92507370-92507392 ACCCAAAATGTCTCCAAACATGG - Intergenic
911693528 1:100862325-100862347 ACCAAAAATCTCTCCAGACGTGG + Intergenic
912702005 1:111885010-111885032 ACCAAAAATGTCTCCAGACATGG + Intronic
913265802 1:117042670-117042692 TCCAAAAGTGTCTCCAAACAGGG + Intergenic
915607467 1:156961850-156961872 ACTAAAAATGTCTCCAGACATGG - Intronic
915877517 1:159627557-159627579 AACAAGATTCCCTCCAGGCACGG + Intergenic
916235262 1:162581210-162581232 ACAAAGATTGTTTCCAAACTAGG - Intronic
918417504 1:184326818-184326840 ACCAAAAATGTCTCTAGACATGG + Intergenic
920707997 1:208268919-208268941 ACCAGCCTTGTCTCCAGACAGGG - Intergenic
921028915 1:211319199-211319221 ATCAAAAATGTCTCCAGACATGG + Intergenic
922123387 1:222697941-222697963 ACCAAATTTGACTCAAGACAGGG + Intronic
923311648 1:232741304-232741326 ACCAAGATTTATTCCAGACAGGG + Intergenic
1063383857 10:5603734-5603756 ACCAATGTTGTCTCCAGAGCTGG - Intergenic
1072894115 10:99350963-99350985 AACCAGATTGTCTCCATACATGG + Intronic
1073691901 10:105818858-105818880 CCCATGTTTGTCTTCAGACACGG - Intergenic
1074119325 10:110481742-110481764 ACCCAAAATGTTTCCAGACATGG + Intergenic
1074259738 10:111839985-111840007 GCCAAGAGTTTTTCCAGACAGGG + Intergenic
1075538890 10:123295708-123295730 AACTAAAATGTCTCCAGACATGG + Intergenic
1076095626 10:127733297-127733319 ACCAAAAATGTCTTCAGACATGG - Intergenic
1077590568 11:3487803-3487825 ACCAAAATTGTCTCCAGACATGG - Intergenic
1078459194 11:11500475-11500497 ACCAAAAACATCTCCAGACATGG - Intronic
1078985209 11:16587570-16587592 ACCAATATTATCTCCATCCATGG + Intronic
1081591271 11:44424904-44424926 ATCAAAAATGTCTCCAGCCATGG - Intergenic
1082989026 11:59191532-59191554 ACCAAAAATGTCTCCAGACATGG - Intronic
1083693788 11:64429006-64429028 ACCAAAGATGTCTCCAAACATGG - Intergenic
1084246289 11:67859584-67859606 ACCAAAATTGTCTCCAGACATGG - Intergenic
1084359626 11:68661088-68661110 ACCAGCGATGTCTCCAGACATGG + Intergenic
1084826393 11:71734916-71734938 ACCAAAATTGTCTCCAGACATGG + Intergenic
1086329275 11:85737574-85737596 ACCAAATGTGTCTCCAGAGAAGG - Exonic
1086496747 11:87411902-87411924 CCAAAAAATGTCTCCAGACAAGG + Intergenic
1087195707 11:95302472-95302494 AACAAGTTTGTCTCTACACAAGG - Intergenic
1087823427 11:102737335-102737357 CCCAAGACTGTCTCCAGATGGGG - Intergenic
1088353826 11:108920867-108920889 ACTAAAAATGTCTTCAGACATGG + Intronic
1088385364 11:109248539-109248561 CCCCAGATTTTCTCCAGTCAGGG + Intergenic
1089575000 11:119435649-119435671 ACCAAAAATGTCTCCAGACATGG - Intergenic
1091205802 11:133820156-133820178 TCCAATCTAGTCTCCAGACAGGG + Intergenic
1092416855 12:8296708-8296730 ACCAAAATTGTCTCCAGACATGG - Intergenic
1092610478 12:10167185-10167207 ACCAAGATTTTGGCCAGGCACGG + Intronic
1093512262 12:19943482-19943504 ACCATGATGGACTCCAGATAAGG - Intergenic
1093710827 12:22328015-22328037 ACCAAATATGTCTCCAGACTTGG - Intronic
1094165075 12:27435316-27435338 ACCAAAAATGTCTGCAGACAGGG + Intergenic
1099282728 12:80672989-80673011 ACCAAGATTGTGTTTAAACAAGG - Intronic
1100281232 12:93120175-93120197 ATCATGAATGCCTCCAGACAAGG - Intergenic
1100536475 12:95515276-95515298 ACCTAGATTGTTTCCCGACAAGG - Exonic
1101268116 12:103113538-103113560 ACCCAAAATGTCTCCAGACATGG - Intergenic
1101878631 12:108611452-108611474 ACCAAACACGTCTCCAGACATGG + Intergenic
1102401392 12:112632694-112632716 ATCAAAATTGTCTCCAGGCATGG - Intronic
1102624291 12:114222205-114222227 ACTAAGAATATCTCCACACATGG - Intergenic
1102908895 12:116697534-116697556 ACCCCGAATGTCTCCAGACATGG - Intergenic
1104615919 12:130268495-130268517 ACCAAAAATGTCTCCAGACATGG - Intergenic
1105074599 12:133264619-133264641 ACCGAGATTCTCCCCAGCCAAGG + Intergenic
1106657645 13:31763379-31763401 ACCAAAAGTGTCTCCAGGCTGGG - Intronic
1107377122 13:39815934-39815956 ATCAAAAATATCTCCAGACATGG + Intergenic
1108669953 13:52675896-52675918 ACCCACAATGTCTCCAGACATGG + Intronic
1108698527 13:52924326-52924348 ACCAAAAATGTCTCTAGACATGG - Intergenic
1108915738 13:55608680-55608702 ACCAAAAATATTTCCAGACATGG - Intergenic
1112359590 13:98705451-98705473 ACAAAAAATGTCTCCAGAGATGG + Intronic
1114501536 14:23172687-23172709 ACCAAAAGTGTCTCCAGATACGG - Intronic
1115171625 14:30514461-30514483 ACCAAGATTATGCCCAGAGATGG + Intergenic
1116352895 14:43888137-43888159 ACCATAAATGTCTTCAGACATGG + Intergenic
1118335885 14:64853289-64853311 GCCAAGATTGTCCCCAAAGAGGG + Intronic
1120210211 14:81626803-81626825 ACCAAAAATGTCTTCAGTCATGG + Intergenic
1121520340 14:94581791-94581813 ACCAAATGTGTCTGCAGACATGG - Intronic
1123073099 14:105651750-105651772 GCAAAGACTGTTTCCAGACAAGG + Intergenic
1123107446 14:105849239-105849261 GCAAAGACTGTTTCCAGACAAGG - Intergenic
1124089226 15:26582114-26582136 ACCATGATTCTCTGCAGAGAAGG + Intronic
1124169397 15:27359169-27359191 ACCAAGATTGACTACATGCAGGG + Intronic
1124570438 15:30858071-30858093 ACCAAGTTTGTGTCCAGTGAGGG + Intergenic
1125692781 15:41610316-41610338 ACTAAGATTCTCTCAGGACAGGG + Intergenic
1126022996 15:44420446-44420468 AGCAAGACTGTCTCCAGGCCGGG - Intergenic
1127684872 15:61333549-61333571 ACAAATATTGTATCTAGACATGG - Intergenic
1129051638 15:72786047-72786069 ACCCAAATTGCTTCCAGACATGG + Intergenic
1129918522 15:79296782-79296804 ACCAAAAATGTCTCTAGACGTGG + Exonic
1130092678 15:80834105-80834127 TCCCAAAATGTCTCCAGACATGG + Intronic
1130762954 15:86839704-86839726 ACCAAAATTGCCTCCTGTCAAGG + Intronic
1130774471 15:86964420-86964442 ACAAAAAATGTGTCCAGACATGG + Intronic
1130935170 15:88464060-88464082 ACCAAAAATATCTCTAGACATGG - Intronic
1130980444 15:88808586-88808608 ACAAAAAATGTCTCCAGACATGG - Intronic
1131091927 15:89629975-89629997 ACCAAAAGTATCTCCAGCCATGG + Intronic
1131156389 15:90078610-90078632 ACCATAAATGTCTCCAAACATGG - Intronic
1131394191 15:92073795-92073817 AGCAAAACTGTCTTCAGACATGG + Intronic
1132029576 15:98428936-98428958 ACCAAAAATATCTCCAGACATGG + Intergenic
1133174811 16:4006142-4006164 ACCAAAAATGTCTCCAGACATGG - Intronic
1133274836 16:4631464-4631486 ATCACAAATGTCTCCAGACATGG - Intronic
1133355937 16:5136888-5136910 ACCAAAACTGTCTCCAGACATGG - Intergenic
1133661675 16:7924293-7924315 ACCACCACTATCTCCAGACATGG - Intergenic
1133755377 16:8758679-8758701 ACCAAAAATGTCTGCAGACATGG + Intronic
1133826244 16:9280707-9280729 ACCAAAAATGTCTCTAGATATGG - Intergenic
1134009218 16:10838875-10838897 ATGCAGAATGTCTCCAGACATGG + Intergenic
1134135382 16:11673606-11673628 ACCAGAAGTGGCTCCAGACATGG + Intronic
1134213406 16:12297014-12297036 ATCACAAATGTCTCCAGACATGG + Intronic
1134394194 16:13848095-13848117 AGCCAAAATGTCTCCAGACATGG + Intergenic
1134827411 16:17295707-17295729 AACAAAAATGTCTCCAGACATGG - Intronic
1134860430 16:17555670-17555692 ATCAAAAATGTCTCCAGACATGG + Intergenic
1135142441 16:19933171-19933193 TCCAAAAATGTCTCCAGACATGG - Intergenic
1135350064 16:21721375-21721397 ACCAAAAATGTTTGCAGACATGG - Intronic
1137294064 16:47073409-47073431 AGCAAAACTGTCCCCAGACATGG - Intergenic
1138581074 16:57940708-57940730 ACCAAGATTGCCTGGAGACTGGG - Intronic
1139255227 16:65534663-65534685 ACCAAGAATCTCTTCAGACAGGG + Intergenic
1140556293 16:75925224-75925246 ACCCAAAATGTCTCAAGACATGG + Intergenic
1140700189 16:77574536-77574558 ACCAAAAATGAATCCAGACATGG + Intergenic
1141440007 16:84024124-84024146 ACCCAAAATGTCTGCAGACATGG + Intronic
1141475586 16:84270955-84270977 TCGAAGATTGTCTCCAAATAGGG - Intergenic
1141746713 16:85931070-85931092 ACCAAAAATGTCTCCAGACATGG - Intergenic
1141756132 16:85992200-85992222 ACAAAAAATGTCCCCAGACATGG + Intergenic
1143662274 17:8333063-8333085 ACCAGGGCTGTCTCCAGACTAGG + Intergenic
1144288968 17:13807216-13807238 ACCAGGGCTTTCTCCAGACATGG - Intergenic
1144398244 17:14867115-14867137 AGGAAGAGGGTCTCCAGACAGGG + Intergenic
1144662544 17:17080555-17080577 ATCAAGGATGACTCCAGACATGG - Intronic
1144757867 17:17691185-17691207 ACCAAAAATGTCTCCTGACATGG - Intronic
1146720096 17:35118157-35118179 ATCAAAAATGTCTCCTGACATGG - Intronic
1147546664 17:41407264-41407286 AGCAAGTTTGTCTCCAAAGATGG + Intergenic
1147678040 17:42220677-42220699 ACCAAGATTCTCTCAGGAAAGGG + Intronic
1147688006 17:42298895-42298917 ACCAAGATTCTCTCAGGAAAGGG - Intronic
1147855119 17:43473932-43473954 ACCAAAAATGTCTCCAGACATGG - Intergenic
1150383625 17:64740278-64740300 ACCAAAAATGTCTCCAGGCCAGG + Intergenic
1151102530 17:71572328-71572350 GCCAAAAGTGTCTCCAAACATGG + Intergenic
1151179119 17:72312903-72312925 AGCAAAACTGTCTCCAGACATGG + Intergenic
1152217011 17:79039209-79039231 ACAAAAAATGTCTCCAAACATGG - Intronic
1155314921 18:24562069-24562091 AACAAGACTGATTCCAGACATGG - Intergenic
1156004044 18:32419281-32419303 ACCAAGATAGTCTCCCTCCATGG + Intronic
1157315624 18:46587087-46587109 ACCAATATTGTCTCCTCATAGGG + Intronic
1157775389 18:50391437-50391459 ACCAAAAATGTCTCCAGACATGG - Intronic
1161328660 19:3675861-3675883 ACCACAGATGTCTCCAGACATGG + Intronic
1161523049 19:4736558-4736580 ACCACAAATGTCCCCAGACATGG - Intergenic
1161938060 19:7384294-7384316 ATCAAAAATGTCTCCAGACATGG + Intronic
1163399491 19:17083498-17083520 ACCAGAAATGTCTCCAGACATGG + Intronic
1163540205 19:17904336-17904358 ATCAAAATTGTTTCCAGACATGG + Intergenic
1164460079 19:28439352-28439374 ACCTAGAATGTCTCCAGGCATGG - Intergenic
1164785424 19:30926635-30926657 ACCAAGATCATCTCCTGAGAAGG - Intergenic
1165526868 19:36363550-36363572 ACCAAAATTGTCTCCAGATATGG - Intronic
1165754965 19:38287696-38287718 ACCAAGATTGCCTCCCGAAGAGG - Intronic
1168416948 19:56175344-56175366 AACAAAACTGTCTCCAGACTTGG + Intergenic
1168421586 19:56207679-56207701 AACAAAAATGTCTCTAGACATGG - Intronic
925574227 2:5343937-5343959 ACCAGTATTGTCTCCACAGATGG - Intergenic
927112864 2:19876768-19876790 ACCAAGATGCTCTCCAAAGATGG + Intergenic
929607312 2:43243290-43243312 ACCAAAAATGTCTCCAGACACGG - Intronic
936864938 2:117066636-117066658 ACCAAATATGTCTCCAGACCTGG - Intergenic
937345750 2:121124378-121124400 ATCTAGAGTGTCTCCAGCCAAGG - Intergenic
937524780 2:122754955-122754977 ACCAAAAATGTCCCTAGACATGG + Intergenic
938663373 2:133509675-133509697 ATGAAAACTGTCTCCAGACATGG - Intronic
940150253 2:150592226-150592248 ACCAAAAATGTCTGGAGACATGG + Intergenic
941146450 2:161852605-161852627 CTTAAGATTGGCTCCAGACATGG + Intronic
941684300 2:168432011-168432033 ACGAAGATTGTCACCAGCCAAGG - Intergenic
942742022 2:179192097-179192119 AACCAGAATGTCTCTAGACATGG + Intronic
942773823 2:179556560-179556582 GCCAAAATTATCTCCAGACAGGG + Intronic
942926371 2:181437940-181437962 ACCATGACAGTATCCAGACAGGG + Intergenic
943149307 2:184091352-184091374 AAAAAGATTGTCCACAGACAAGG - Intergenic
945937717 2:215920096-215920118 AACAAGATTGTTTGCAGATAGGG - Intergenic
945939452 2:215933506-215933528 GCTAAGAATGTCTCCAGATATGG + Intergenic
946962360 2:224998472-224998494 ACAGAGATTGTTTCCAGAGAAGG - Intronic
947704386 2:232262506-232262528 ATCAAAAATGTCTCCAGACATGG - Intronic
948475243 2:238214106-238214128 AGCAAGACTGTCTCCAAAAAAGG - Intergenic
1169119739 20:3088079-3088101 ACCAAGCTTGTTTCCAGGCCAGG - Intergenic
1169849075 20:10031133-10031155 ACCAACTTTGTCTCCAAACATGG + Intronic
1170374485 20:15685553-15685575 ACCTAGATTGAATCTAGACAAGG + Intronic
1170472645 20:16683623-16683645 ATCAAAAATGTCTCCAGACCAGG - Intergenic
1170539850 20:17376456-17376478 GCCAATATTCTCTCCAGACTGGG - Intronic
1172301327 20:33852571-33852593 ACCAAAAATGTCTTCAGACATGG + Intronic
1173114321 20:40225587-40225609 GCCAAAACTGTCTCCACACATGG - Intergenic
1174502771 20:50997673-50997695 CCCATGACAGTCTCCAGACAGGG + Intergenic
1174565032 20:51458361-51458383 ACCAAGATTGTCTCCAGACAAGG + Intronic
1175154339 20:56959554-56959576 ACCAAAAATGTCTCCGGACATGG + Intergenic
1175266339 20:57705777-57705799 GCCAGAAATGTCTCCAGACATGG - Intronic
1179025700 21:37676705-37676727 ATCAAAAATGTCTCCAGACATGG - Intronic
1179117972 21:38511889-38511911 ACCAAAACTGTCTTTAGACATGG + Intronic
1179120056 21:38536003-38536025 CCCAAGATTGGGTCCAGAAATGG - Intronic
1179389469 21:40974349-40974371 ACCAAAAGTGTATCCACACATGG + Intergenic
1181775017 22:25153329-25153351 ACCAAAAATGTCTCCAGACAAGG - Intronic
1183396744 22:37575998-37576020 ACCAAGAATGTCTCCAGACAGGG + Intronic
1183725807 22:39589120-39589142 ACCAAAAATGTCTCCAGACACGG + Intronic
1184928451 22:47661165-47661187 ACCAAGTTTGGCTCCAGAGGAGG - Intergenic
952000144 3:28775698-28775720 ATCAAAAATGTCTCCAGGCATGG - Intergenic
953394640 3:42558024-42558046 ACCAGAAATGACTCCAGACATGG - Intronic
953734226 3:45477535-45477557 ACAAAGATTGTCCCCAGGGAGGG + Intronic
955482764 3:59406024-59406046 ACATATATTTTCTCCAGACATGG + Intergenic
955738836 3:62067867-62067889 ACCAAAAATGTCTCTAGACATGG + Intronic
955740671 3:62088140-62088162 ACCTAAAGTGTTTCCAGACATGG - Intronic
955744952 3:62131257-62131279 ACGAAAAACGTCTCCAGACATGG + Intronic
955761784 3:62292670-62292692 AGCAAAAAAGTCTCCAGACATGG - Intronic
955775435 3:62427595-62427617 ACCAGGAATGTCTCCAGACATGG + Intronic
956067846 3:65415787-65415809 ACCAATAATGTCTTCAGACAGGG - Intronic
957526615 3:81386353-81386375 ACCAAAATTGTGTTCAGAAAGGG + Intergenic
957987993 3:87595922-87595944 GCCAAAATTGCCTCCAGACTAGG + Intergenic
960198481 3:114800801-114800823 AGCAAGAATCTTTCCAGACAGGG + Intronic
960603741 3:119483808-119483830 ATCAAAAATGTCTACAGACATGG + Intronic
961502272 3:127345026-127345048 ATCAAGATTGTCTGGGGACAGGG - Intergenic
961894407 3:130155309-130155331 ACCAAAATTGTCTCCAGACATGG - Intergenic
962399689 3:135047800-135047822 AACCAAAATGTCTCCAGACATGG - Intronic
963237512 3:142970336-142970358 CCCAGTACTGTCTCCAGACAGGG - Intronic
963711308 3:148750787-148750809 ACCAAAAGTGATTCCAGACATGG - Intergenic
964249330 3:154692363-154692385 ACCAAAAATGTCTACAGACATGG - Intergenic
964880710 3:161419652-161419674 ACCACAACTATCTCCAGACATGG + Intergenic
965598302 3:170429701-170429723 AACAAGATTATCTTCACACAGGG - Intronic
967232208 3:187350606-187350628 ACCAAAACTGACTCCAGACAAGG + Intergenic
967503022 3:190222264-190222286 ACACAGCTTGTCACCAGACAAGG - Intergenic
967984597 3:195085645-195085667 ACTAGGATTGTCACCAGACACGG - Intronic
969004497 4:4008388-4008410 ACCAAAACTGTCTCCAGACATGG - Intergenic
969249716 4:5959036-5959058 ACCAAAAATGTCTCCAGACATGG + Exonic
969748371 4:9091760-9091782 ACCAAAACTGTCTCCAGACATGG + Intergenic
969809402 4:9636319-9636341 ACCAAAACTGTCTCCAGACATGG + Intergenic
973335928 4:48956341-48956363 AACAAGATTGTCTTCAAAAAAGG + Intergenic
973561856 4:52144916-52144938 TTCAATATGGTCTCCAGACATGG + Intergenic
976337393 4:83906162-83906184 ACCAAAAATGTCTCCAGACATGG + Intergenic
978038980 4:104034792-104034814 GCCAAGATTATGTCCAAACATGG - Intergenic
978343185 4:107738875-107738897 GGCTAGAATGTCTCCAGACAAGG + Intergenic
978946712 4:114508301-114508323 CCCATGGTTGTTTCCAGACAGGG - Intergenic
983646828 4:170000010-170000032 ACCAAAAATGTCTCCAGACTTGG + Intronic
984385699 4:179054506-179054528 ACCAAGATTGTCTTCAGAGAGGG - Intergenic
984498736 4:180532013-180532035 ACCAAAAATGTCTCCAGAAATGG - Intergenic
985118058 4:186611504-186611526 AACAAGAATGTCCTCAGACACGG + Exonic
986732554 5:10645906-10645928 ACCAAAAATGTCTACAGACGTGG - Intronic
987259726 5:16190910-16190932 ACCAAAAATGTCTCCAGACATGG - Intergenic
989371725 5:40717617-40717639 AACAAAAATGTCTCTAGACATGG + Intronic
989438466 5:41441834-41441856 ACCCAGGTTGTCTCCACACATGG + Intronic
990669526 5:58112558-58112580 ACTAAAAATGTCTCCAGACATGG + Intergenic
991201018 5:63992735-63992757 ACCAAGATTCTTTCCAGGTAAGG + Intergenic
993034852 5:82745501-82745523 ACCAAAACTGTCTCCAGACATGG + Intergenic
993247441 5:85468609-85468631 ACCCAGATTTGCTTCAGACATGG + Intergenic
994109771 5:95988136-95988158 AGCAAAAATGTCTCCACACAAGG - Intergenic
994550714 5:101231539-101231561 ACCAAGACTGGCTACAAACAAGG - Intergenic
996785347 5:127231013-127231035 ACCAAGATAGTGTCCAGATTTGG - Intergenic
996895772 5:128480680-128480702 GCCAAGATTGTCGCCAGCCTGGG + Intronic
997149150 5:131473135-131473157 ACCAAGATTTTCTGGAGAAAGGG - Intronic
997747869 5:136315463-136315485 ACCCAGATTCTCTTTAGACAGGG - Intronic
997868247 5:137483755-137483777 ACCAAAAATGTCTCCAGACAGGG + Intronic
997926711 5:138036826-138036848 ACCAAAAATGTCTGCACACATGG - Intronic
1000497238 5:162000013-162000035 ATCAAAATTGTCTCCAGAAGTGG + Intergenic
1001017975 5:168158654-168158676 ATCAAAAATGTCTCCAGACTGGG + Intronic
1001434021 5:171685626-171685648 ACCAAGAGGGTCCCCAGACTTGG - Intergenic
1001485023 5:172113624-172113646 ACTAATATTGTCACCGGACACGG + Intronic
1002463582 5:179389608-179389630 GTCAAAAATGTCTCCAGACATGG - Intergenic
1003877489 6:10451373-10451395 ACCCAGAAGGTCTCCAAACATGG - Intergenic
1004608316 6:17214716-17214738 ATCAAAAATGTCTCCAGACATGG - Intergenic
1005187092 6:23174702-23174724 ATCAAAATTTTCTCCATACATGG + Intergenic
1005256292 6:24007002-24007024 AGCAAAAATGTCTCCAGACGTGG - Intergenic
1006410660 6:33871483-33871505 AACAAGAGGGTCTCCAGGCATGG - Intergenic
1006529833 6:34642410-34642432 ACCCAGATTAGCTGCAGACAAGG + Intronic
1006751203 6:36378794-36378816 ACTAAAAATGTCTCCAGACACGG + Intronic
1007521841 6:42456027-42456049 ACCCAGGTTGCCTCCAGAGAAGG - Intergenic
1007688938 6:43685497-43685519 ACCAAAAATGTCTGCAGACATGG + Intronic
1009213487 6:60891436-60891458 AACAAAAATGTCCCCAGACATGG + Intergenic
1009438061 6:63640932-63640954 GCCAAAAATGTCTCTAGACATGG + Intronic
1012358064 6:98340840-98340862 ACCAAAAATGTCTCCTGACATGG - Intergenic
1013343243 6:109236048-109236070 ACCAGAAGTATCTCCAGACATGG + Intergenic
1013750901 6:113404990-113405012 ACTAAAAGTGTCTCCAGACATGG + Intergenic
1015906045 6:138117892-138117914 ACAAATATTCTCACCAGACAGGG + Intergenic
1018344740 6:162888660-162888682 ACCAAGTGTGTCTTCAGAAAGGG - Intronic
1018727214 6:166622620-166622642 AACAATATTGGCTCCAGTCATGG - Intronic
1020021514 7:4872232-4872254 ACCAAAGATGTCTGCAGACATGG - Intronic
1020324633 7:6964887-6964909 ACCAAAATTGTCTCCAGACATGG - Intergenic
1021523662 7:21562302-21562324 ATCATAAATGTCTCCAGACATGG + Intronic
1022341920 7:29476708-29476730 ATAAAAAATGTCTCCAGACATGG - Intronic
1023618958 7:42049995-42050017 ACCAAGATTATATTCTGACAGGG - Intronic
1027809757 7:82880592-82880614 ACCAAAAATGTTTCTAGACATGG - Intronic
1029460442 7:100691204-100691226 ACCCAGAATGTCTCTAGACTTGG - Intergenic
1029935967 7:104424578-104424600 ACCAAAAATGTCTCCAGACCTGG - Intronic
1030490025 7:110220699-110220721 ACCAAAAATATCTTCAGACATGG - Intergenic
1031515279 7:122691830-122691852 CCCCAGAATGTCTCCAGGCATGG + Intronic
1032022695 7:128418539-128418561 ACCAAAAATGTCTTCAGACACGG - Intergenic
1033069764 7:138191390-138191412 ACCAAGATTCACTCCAGCCTAGG + Intergenic
1035496878 7:159335615-159335637 ACCGAGATTCTCCCCAGCCAAGG + Intergenic
1036371433 8:8166054-8166076 ACCAAAATTGTCTCCAGACATGG + Intergenic
1036879470 8:12499590-12499612 ACCAAAATTGTCTCCAGACATGG - Intergenic
1037818189 8:22122789-22122811 ACCCAGTTTGTCTCCAGCCAGGG - Exonic
1038932535 8:32210557-32210579 TCTAAGATTGTCTACAGCCACGG + Intronic
1040412489 8:47168510-47168532 AGCAAGAATGTCTCCATCCAAGG - Intergenic
1041024025 8:53665963-53665985 CCAGACATTGTCTCCAGACAAGG - Intergenic
1041584466 8:59499651-59499673 AGCAAGATTGAATCCAGAAAAGG - Intergenic
1043980676 8:86635306-86635328 AACAAGATTCTCTCCCAACATGG + Intronic
1045659059 8:104417524-104417546 ACCAAGATCTTCTACAGAAATGG + Intronic
1045690390 8:104754165-104754187 ACCAAAAATGTCTCCAGGCTGGG - Intronic
1046017586 8:108623798-108623820 ATCAAAAATGTCTCCAGACATGG - Intronic
1047693751 8:127383120-127383142 CCCAAAAATGTCTCCAGACATGG + Intergenic
1048503370 8:134998766-134998788 ACCAAAAGTCTTTCCAGACAGGG - Intergenic
1050026268 9:1337429-1337451 GCCAAAAATATCTCCAGACACGG - Intergenic
1050668613 9:7969882-7969904 ACCAAAAATGTCTCTGGACATGG - Intergenic
1050911536 9:11077727-11077749 ACACAGATTCTCTCCATACAGGG + Intergenic
1055645140 9:78356102-78356124 ACCAAAAATGTCTCTAGACATGG - Intergenic
1056827209 9:89884560-89884582 ACACAGATTGTCTCCAGACAGGG - Intergenic
1059604779 9:115822743-115822765 ATCAATAGTGTCTCCAGATAAGG - Intergenic
1060062578 9:120474362-120474384 ACCAAAAATGTCTCCAGACATGG - Intronic
1060820124 9:126656859-126656881 ATCAAAAATGTCTCCAGACATGG + Intronic
1061701333 9:132418218-132418240 ACCAAAAATGTCTCCAGACGTGG - Intronic
1061712000 9:132494369-132494391 ACCAAAAATATGTCCAGACATGG + Intronic
1062275601 9:135728898-135728920 ACCACGATTGTCACGTGACATGG + Intronic
1185539293 X:889336-889358 ACCAACAGTGTCTCCAAACATGG - Intergenic
1185798899 X:2991692-2991714 AACAAAAATGTCTCCAGACATGG - Intergenic
1186157279 X:6738628-6738650 ACCCAAAATGTCTCCAGACATGG - Intergenic
1186157369 X:6739467-6739489 ACCAAAAATGTCCTCAGACATGG - Intergenic
1186239599 X:7552331-7552353 ACCAAGAATGTCTCCAGATATGG - Intergenic
1186515521 X:10163906-10163928 ACAAAAAATGTCTCTAGACATGG + Intronic
1186614435 X:11171867-11171889 ACCAGAATTATCTCTAGACATGG + Intronic
1187408347 X:19024585-19024607 ACCAAAAATGTCTCCAGACATGG - Intronic
1188660759 X:32755294-32755316 AAAAATATTGTCTTCAGACAAGG + Intronic
1189096939 X:38150433-38150455 ACCAAAAATATCTCCAGACATGG - Intronic
1193422365 X:81296607-81296629 GGCAAGATTGACTCCAGAAAAGG - Intronic
1194087634 X:89548532-89548554 ACTAACATTTTCTCCAGAAAAGG + Intergenic
1194467915 X:94255885-94255907 ACCAAGCATGGCCCCAGACATGG + Intergenic
1194613397 X:96071921-96071943 ATCAAAATTATCTCCAGAAAGGG - Intergenic
1195641653 X:107182319-107182341 ACCAAAAATGTCTCCAGATTTGG + Intronic
1195765972 X:108297511-108297533 ACCAAAAATGTTCCCAGACATGG + Intronic
1195999056 X:110761583-110761605 ACCAAAAATGTCTCCAGACATGG - Intronic
1197518733 X:127471719-127471741 TCAAATATTGTCTCCAGAGATGG - Intergenic
1198176646 X:134162941-134162963 AGCAAGATTATATCGAGACAAGG + Intergenic
1198603099 X:138306426-138306448 TCCATGATTGTCTCATGACAAGG - Intergenic
1199162091 X:144624829-144624851 ATCAGAAATGTCTCCAGACAGGG - Intergenic
1199238569 X:145519073-145519095 ACTAAGATTTTCTCAAGTCAAGG - Intergenic
1200440277 Y:3204402-3204424 ACTAACATTTTCTCCAGAAAAGG + Intergenic
1200750686 Y:6941693-6941715 ACCAAGAAATACTCCAGACAAGG - Intronic
1201245150 Y:11996213-11996235 ACCAAAAATGTCTCTAGATATGG + Intergenic
1201550902 Y:15215423-15215445 ACCCAAAATGTCTCCAGACATGG - Intergenic