ID: 1174566020

View in Genome Browser
Species Human (GRCh38)
Location 20:51465036-51465058
Sequence AGGTGCTAATCAATACTTGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 152
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 141}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1174566020_1174566021 -10 Left 1174566020 20:51465036-51465058 CCTTCAAGTATTGATTAGCACCT 0: 1
1: 0
2: 0
3: 10
4: 141
Right 1174566021 20:51465049-51465071 ATTAGCACCTACTATGTGCTAGG 0: 1
1: 8
2: 159
3: 1000
4: 3435
1174566020_1174566023 30 Left 1174566020 20:51465036-51465058 CCTTCAAGTATTGATTAGCACCT 0: 1
1: 0
2: 0
3: 10
4: 141
Right 1174566023 20:51465089-51465111 ATTAAAATAGAAATCACAGCTGG 0: 1
1: 1
2: 4
3: 75
4: 694

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1174566020 Original CRISPR AGGTGCTAATCAATACTTGA AGG (reversed) Intronic
900971503 1:5994566-5994588 AGGTGCTAGTCAACACCTGGGGG + Intronic
907496236 1:54846720-54846742 AGGTTCTTATCAATACCTAAGGG + Intergenic
913330604 1:117663943-117663965 AGGTGCTAAACCATTCATGAGGG - Intergenic
916364916 1:164015307-164015329 AGGTACTAATCCATTCATGAGGG - Intergenic
920157390 1:203965417-203965439 AGGTGCTAAGCACTAACTGATGG + Intergenic
922268110 1:224006413-224006435 AAGTGGGAATCAATACTAGAAGG - Intergenic
922681814 1:227604690-227604712 AAATGCTAATCAAAACTTCAGGG - Intronic
923621426 1:235582495-235582517 AGCACCTAATCTATACTTGAAGG - Intronic
1063000268 10:1911416-1911438 AGATTCTAATGAATACTTCATGG + Intergenic
1064217565 10:13413191-13413213 AGGTGCTAAGCCATTCATGAAGG + Intergenic
1064628579 10:17286135-17286157 TGGTGCTAGACCATACTTGAAGG + Intergenic
1066725587 10:38389196-38389218 AAGTGGGAATCAATACTAGAAGG + Intergenic
1068198204 10:53745864-53745886 TGGTGCTAAACCATTCTTGAAGG + Intergenic
1071173860 10:82900181-82900203 TGGTGCTAAACAATTCATGAGGG + Intronic
1071252137 10:83829789-83829811 AGCTGCTAATAAATAATTTAGGG + Intergenic
1071777949 10:88810175-88810197 TGGTGCTAATAAATATTTGCGGG + Intronic
1072475776 10:95758492-95758514 GGGGGCTAATCTAGACTTGAAGG - Intronic
1075032656 10:119035731-119035753 AGGTGTTACTCAATACCTGAAGG + Exonic
1075286082 10:121187432-121187454 AGGTCCTATTCTATTCTTGAGGG - Intergenic
1078229715 11:9429165-9429187 GATTGCTGATCAATACTTGAAGG - Exonic
1080061289 11:27959549-27959571 GGATGCTCTTCAATACTTGAGGG - Intergenic
1082283011 11:50290848-50290870 AAGTGGTAATTAATACTTGAAGG + Intergenic
1086832722 11:91585250-91585272 AGATGAAAATCAAGACTTGAAGG + Intergenic
1088175541 11:107049180-107049202 AGGTACTAATCTAGACCTGAGGG - Intergenic
1091842696 12:3632061-3632083 AGGTGCTAAACCATTCATGAAGG - Intronic
1095507860 12:42916752-42916774 TGGTGCTAATAAATACTTCATGG + Intergenic
1097621897 12:61948971-61948993 AAGTGCTAAGCAATAAATGATGG - Intronic
1097945886 12:65366943-65366965 TGGTGCTCACCAATACTTAAGGG + Intronic
1105825913 13:24123217-24123239 GATTGCTGATCAATACTTGAAGG + Intronic
1105941785 13:25154132-25154154 TGGTGCTAATAATAACTTGAAGG - Intergenic
1106886672 13:34192623-34192645 AGGCACTAATCAATTCGTGAGGG + Intergenic
1107510883 13:41082899-41082921 AGGTGATGATCAATAGTTGCAGG + Exonic
1107734741 13:43387050-43387072 AGGTACTTATTAATACTTGCTGG - Intronic
1115101706 14:29709092-29709114 AGGTGCTAATCAATAGATATAGG - Intronic
1116126456 14:40794785-40794807 AGATGCTAATCAATACTGGCTGG - Intergenic
1116233559 14:42248903-42248925 GGGTGCTAATCCATTCATGAGGG - Intergenic
1117450811 14:55848019-55848041 TGGTGCTAATAAAAACTTTATGG + Intergenic
1120037920 14:79718948-79718970 AGGTGCTGATCAAGAGTTGGAGG - Intronic
1120243020 14:81972220-81972242 AGGTGCTACCCAGTAATTGAGGG - Intergenic
1121166849 14:91810227-91810249 TGGTGCTAAGCCATACATGAGGG + Intronic
1121946677 14:98129841-98129863 AGGGGCAAATGAATAATTGATGG - Intergenic
1124201573 15:27682738-27682760 AGGTGCTAATCCATGTTTGATGG - Intergenic
1125121002 15:36158725-36158747 AGGTGCTAATCAGGATTTGGGGG - Intergenic
1125256347 15:37768388-37768410 CGGTGCTAAGCAATTCATGAGGG + Intergenic
1126261159 15:46693495-46693517 AGGTGCTGAAGAATACATGATGG + Intergenic
1126544850 15:49862214-49862236 CAGTGCTGATGAATACTTGAAGG - Intronic
1128129109 15:65213961-65213983 ATGAGATAATCAATACTTTATGG - Intergenic
1129015567 15:72465098-72465120 AGGTGTTCATGAAAACTTGAAGG - Intergenic
1130058240 15:80548247-80548269 AAATGCTAAACAATAATTGAGGG + Intronic
1131384464 15:91992099-91992121 AAGTTCTAATCCATACTTCAAGG + Intronic
1138404021 16:56773888-56773910 AGGTGCTTATAAATTCTTTATGG - Intronic
1138891307 16:61147314-61147336 AGGTGCTCATCAACAGTGGATGG - Intergenic
1143332058 17:6144747-6144769 AGGTTCTAATCCATACCAGATGG + Intergenic
1145975616 17:28982202-28982224 AGGTGCTATTACATACTTCAAGG + Intronic
1146306317 17:31732541-31732563 GGGTGTTAACCAAAACTTGACGG - Intergenic
1146928154 17:36759116-36759138 GGGTGCTAATCTATTCATGAGGG - Intergenic
1155616100 18:27723263-27723285 AGTTTCTAAACAGTACTTGATGG - Intergenic
1157432830 18:47643802-47643824 GGGTGCTAATCTATTCATGAGGG - Intergenic
1158498779 18:57981630-57981652 AGCTGATGATGAATACTTGAGGG + Intergenic
1168595990 19:57677799-57677821 ATGTGATAGCCAATACTTGAGGG + Intronic
1168665412 19:58201364-58201386 TGGTGCTAAGCCATTCTTGAAGG + Intronic
926797887 2:16633815-16633837 AGGTGGTAGGAAATACTTGAAGG - Intronic
928036347 2:27827651-27827673 AGGTGGTAATCATTACCTTAGGG - Exonic
931167810 2:59768519-59768541 ATGTGCTAATTAATACTTTCAGG - Intergenic
932254414 2:70271942-70271964 AGGTGTTACTCAATACCTGAAGG + Intronic
937608957 2:123837298-123837320 AGGTGCTAATGAATTCTCCAAGG - Intergenic
937728381 2:125195104-125195126 ATATGCTAATGAATACTAGATGG - Intergenic
945195726 2:207235819-207235841 ATGTGCTAATTATTACTTCAGGG + Intergenic
946949837 2:224861712-224861734 AAGTTCAAATGAATACTTGATGG + Intronic
1168862884 20:1058714-1058736 AGGTGCTAATTAAGATTGGAGGG - Intergenic
1169205913 20:3740318-3740340 TGGTTCTAATCAGGACTTGAGGG - Intronic
1169749396 20:8976228-8976250 AGGCACTAATCAATTCATGAGGG - Intergenic
1169778110 20:9278153-9278175 GTGTGCTTATCAATACTTGGTGG + Intronic
1172636051 20:36410724-36410746 TGGTGCTAAGCCATTCTTGAGGG + Intronic
1173017451 20:39238497-39238519 TGGTGCTCAGAAATACTTGAGGG + Intergenic
1173372224 20:42447280-42447302 AGGTGGTAATCACTTCTTCAGGG - Intronic
1174566020 20:51465036-51465058 AGGTGCTAATCAATACTTGAAGG - Intronic
1177210832 21:18068818-18068840 AGGTGTCAATCAATAACTGAAGG + Intronic
1177715273 21:24832382-24832404 AGTAGCTAATCAATAGTGGAGGG + Intergenic
949303261 3:2609243-2609265 AGGTGCTAATCCATTCACGAGGG - Intronic
949607971 3:5675367-5675389 TGGTGCTAAACCATTCTTGATGG + Intergenic
955862984 3:63352194-63352216 AGTTGATCATCAAGACTTGAAGG + Intronic
956310787 3:67877333-67877355 AGTTGCCTATCTATACTTGAGGG - Intergenic
958485492 3:94702236-94702258 AGGTCCAAATAAATATTTGATGG - Intergenic
962306121 3:134287874-134287896 TGGGGCTAATCAATACTTATAGG - Intergenic
964468864 3:157030230-157030252 TGGTGCTAAGCAATTCATGAAGG + Intronic
965807135 3:172553278-172553300 AGGTGCTAAGCCATTCATGAGGG + Intergenic
971762746 4:30789283-30789305 ATGTGCTGATCAATCCTTGCAGG - Intronic
973041319 4:45473130-45473152 ATTTTCTAATCAATACATGAAGG - Intergenic
974339015 4:60589545-60589567 TGGTGCTAAACCATACATGAAGG - Intergenic
975036153 4:69685593-69685615 AGTCACTAATCAATACATGATGG - Intergenic
975400426 4:73930911-73930933 ATTAGCTAATGAATACTTGAAGG + Intergenic
975450938 4:74525851-74525873 AGCTGCTATTAAATACATGAGGG + Intergenic
975626733 4:76357534-76357556 ATGTGATAATCAATAATAGATGG + Intronic
975780920 4:77839032-77839054 AGGTGCTTAACAATCCTTTATGG - Intergenic
977588081 4:98797312-98797334 AAGTGCAAATATATACTTGAAGG - Intergenic
978124258 4:105117195-105117217 AAGTACCATTCAATACTTGATGG + Intergenic
978137473 4:105280443-105280465 AGATGCTAAACAATAGTTGTGGG + Intergenic
978651287 4:111008319-111008341 AGATTCTAAACAAAACTTGAAGG - Intergenic
981087467 4:140698781-140698803 AGGTACTACTAAATCCTTGAAGG + Intronic
981588689 4:146332435-146332457 TGGTGCTAAACAATTCATGAAGG - Intronic
984075060 4:175166642-175166664 AGGTGTGAAAAAATACTTGAAGG + Intergenic
984353820 4:178632113-178632135 AGGTACTAATCAATACATAAGGG - Intergenic
986111512 5:4723575-4723597 AAGTGTTAATCACTAATTGAAGG + Intergenic
986456427 5:7925140-7925162 ATGTGTTATTCAATAATTGATGG + Intergenic
986969007 5:13310407-13310429 AGGTGCCTTTCAATAGTTGAGGG + Intergenic
990927254 5:61040658-61040680 ATATGCTAATAAATACTTGTGGG - Intronic
991400411 5:66245613-66245635 TGGTGCCAATGAATCCTTGAAGG - Intergenic
991403550 5:66278845-66278867 AGGTGCTAATCCATTCATGATGG + Intergenic
993005635 5:82425593-82425615 TGGTGCTAAACAATTCATGAAGG + Intergenic
999574394 5:152958916-152958938 AGTTATTAATAAATACTTGAAGG - Intergenic
1000668864 5:164034707-164034729 AGGTGCTAAACCATTCATGAGGG + Intergenic
1002855345 6:1032421-1032443 AGGTTTTAATGAATACTTTAGGG + Intergenic
1003686273 6:8305991-8306013 AGGTGCCCATCAATAGATGATGG - Intergenic
1004407027 6:15342461-15342483 AGGTGCTAATAAATTCTAGGAGG - Intronic
1005028482 6:21487188-21487210 CGGTGATAATCAATAATTGAAGG + Intergenic
1007343748 6:41210888-41210910 AGGTTCTGACCAATGCTTGAAGG - Intergenic
1007346542 6:41235318-41235340 AGATTCTGATCAATGCTTGAAGG + Intronic
1008527578 6:52421258-52421280 AGCAACTAATCAATTCTTGAGGG - Intronic
1009025606 6:57996709-57996731 AAGTGCTGATCAATACTTAGTGG + Intergenic
1012360021 6:98365859-98365881 AGTTCCTAATCATTACTTGCTGG - Intergenic
1013178126 6:107694594-107694616 TGGTGCTAATCCATTCATGAAGG + Intergenic
1014740871 6:125146568-125146590 TGGTGCTAATCCATTCATGAGGG - Intronic
1018370082 6:163159991-163160013 AAGTGCTAACCAACACCTGATGG - Intronic
1020496205 7:8855845-8855867 AGATGGTAATCAATATATGATGG - Intergenic
1021260503 7:18451107-18451129 AGGCACTAATCCATTCTTGAGGG - Intronic
1023006514 7:35875695-35875717 AAGTGGTAATCAATACTAGAAGG - Intronic
1024067700 7:45755268-45755290 AAGTGGGAATCAATACTAGAAGG + Intergenic
1025312050 7:57959706-57959728 AGCTGCACATAAATACTTGATGG - Intergenic
1028632269 7:92947850-92947872 AGGTGCTAATAAATACTCCTCGG - Intergenic
1034116407 7:148587488-148587510 AGATGCTAATTAATGCTTGGGGG + Intergenic
1035706145 8:1676765-1676787 GGGTGTTAATTCATACTTGAGGG - Intronic
1039028474 8:33284082-33284104 ATCTGCTAATTAATACATGAAGG + Intergenic
1042275824 8:67004146-67004168 AGGTTCTAATCCATTCATGAAGG - Intronic
1043148697 8:76685274-76685296 ATGTGCAAATCAATATTTCAGGG + Intronic
1046587216 8:116162253-116162275 AGGTACTAATGAAAACTTCAAGG - Intergenic
1051301874 9:15660716-15660738 AGGTGCTCATCAATCAATGATGG - Intronic
1051873823 9:21769647-21769669 AGGTGCTAAACTATTCATGAAGG - Intergenic
1055507912 9:76966723-76966745 TGGTGCTAATCAGTAATAGAAGG + Intergenic
1058611583 9:106782244-106782266 AGTTTCTAAACAATACTTAATGG - Intergenic
1059680257 9:116579088-116579110 AGTAGCAAATCAATACTTGGAGG - Intronic
1059870929 9:118575238-118575260 AGGTGCTGATCAATGGTAGATGG - Intergenic
1060348933 9:122840527-122840549 TGGTGCTAAGCCATTCTTGAGGG + Intergenic
1185855659 X:3532405-3532427 AGGTGTTAAACCATTCTTGAAGG - Intergenic
1186028018 X:5335100-5335122 AGGTCCTAATCCATTCATGAAGG - Intergenic
1187625619 X:21109723-21109745 AGGAGCTAATATATACTTGGGGG + Intergenic
1189205572 X:39235751-39235773 AGGTGCCAAATAATACTTGTTGG + Intergenic
1189470040 X:41306803-41306825 AGGTGCTATTCAATAGAAGATGG + Intergenic
1192787048 X:74345921-74345943 AGGTGCTAATTTTTACTTGGTGG + Intergenic
1193005128 X:76608107-76608129 AGGTGTTGATTAATGCTTGAAGG - Intergenic
1197810063 X:130433361-130433383 AGGTGCTAGTAAATATTTGTGGG - Intergenic
1199404508 X:147441431-147441453 AGGTGCTATTCTATATCTGAGGG + Intergenic