ID: 1174566614

View in Genome Browser
Species Human (GRCh38)
Location 20:51469265-51469287
Sequence CTCAGTGCTTTGAGAGGCTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 44118
Summary {0: 3, 1: 49, 2: 571, 3: 5105, 4: 38390}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1174566614_1174566616 4 Left 1174566614 20:51469265-51469287 CCTTAGCCTCTCAAAGCACTGAG 0: 3
1: 49
2: 571
3: 5105
4: 38390
Right 1174566616 20:51469292-51469314 TAGACGTGAGCCACCGAGCTTGG 0: 1
1: 6
2: 296
3: 5346
4: 54828
1174566614_1174566617 8 Left 1174566614 20:51469265-51469287 CCTTAGCCTCTCAAAGCACTGAG 0: 3
1: 49
2: 571
3: 5105
4: 38390
Right 1174566617 20:51469296-51469318 CGTGAGCCACCGAGCTTGGCTGG 0: 1
1: 20
2: 621
3: 3137
4: 5899
1174566614_1174566618 9 Left 1174566614 20:51469265-51469287 CCTTAGCCTCTCAAAGCACTGAG 0: 3
1: 49
2: 571
3: 5105
4: 38390
Right 1174566618 20:51469297-51469319 GTGAGCCACCGAGCTTGGCTGGG 0: 1
1: 1
2: 184
3: 1851
4: 6744

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1174566614 Original CRISPR CTCAGTGCTTTGAGAGGCTA AGG (reversed) Intronic
Too many off-targets to display for this crispr