ID: 1174568114

View in Genome Browser
Species Human (GRCh38)
Location 20:51481559-51481581
Sequence GCTTCTAGTGCACACCGTGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 60
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 57}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1174568110_1174568114 12 Left 1174568110 20:51481524-51481546 CCCAGGCAGTTGAAAAGGTTCCA 0: 1
1: 0
2: 1
3: 6
4: 116
Right 1174568114 20:51481559-51481581 GCTTCTAGTGCACACCGTGAAGG 0: 1
1: 0
2: 0
3: 2
4: 57
1174568113_1174568114 -8 Left 1174568113 20:51481544-51481566 CCAGGAAGAAGCAGTGCTTCTAG 0: 1
1: 0
2: 0
3: 13
4: 172
Right 1174568114 20:51481559-51481581 GCTTCTAGTGCACACCGTGAAGG 0: 1
1: 0
2: 0
3: 2
4: 57
1174568111_1174568114 11 Left 1174568111 20:51481525-51481547 CCAGGCAGTTGAAAAGGTTCCAG 0: 1
1: 0
2: 0
3: 6
4: 111
Right 1174568114 20:51481559-51481581 GCTTCTAGTGCACACCGTGAAGG 0: 1
1: 0
2: 0
3: 2
4: 57

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1174568114 Original CRISPR GCTTCTAGTGCACACCGTGA AGG Intronic
901106130 1:6758098-6758120 GCTTCCAGTGCAGACTGTAAGGG + Intergenic
902193851 1:14783404-14783426 GCTTCTCGGGGTCACCGTGAAGG - Intronic
906147465 1:43568526-43568548 GGTTCAAGTGCCCACCTTGATGG - Intronic
909325291 1:74343727-74343749 TTTTCTAGAGCACACCGTAAAGG - Intronic
920670772 1:208002357-208002379 GCTAGAAGTGCCCACCGTGATGG - Intergenic
922648841 1:227318875-227318897 GCTTCTGGTGCAGATCGCGAAGG + Intergenic
1065158533 10:22895054-22895076 GCTTCTTGTGCAGACTGGGAGGG - Intergenic
1066333124 10:34446765-34446787 GCTTGCCTTGCACACCGTGATGG - Intronic
1074778339 10:116782925-116782947 GCTTCCAGTACCCTCCGTGAGGG - Intergenic
1077208285 11:1354539-1354561 GCCCCCAGTGCACACCATGAAGG - Intergenic
1078697287 11:13647217-13647239 GCTTCTACTCCACACTGTGTGGG + Intergenic
1084461936 11:69301145-69301167 GCTTCTAGCAGAGACCGTGATGG + Intronic
1090945903 11:131429322-131429344 GGTCCTTGTGCACACTGTGAAGG - Intronic
1096895001 12:54812603-54812625 GGTACAAGTGCACACCGTGCAGG + Intergenic
1099113041 12:78586838-78586860 GCTGCTTGTGCACACCTTGTGGG - Intergenic
1100531816 12:95468253-95468275 GCCTCCAGTGCACTCAGTGAGGG - Intergenic
1114691791 14:24589649-24589671 GGTTCTTGTGCACAACGTGCAGG - Intergenic
1130223691 15:82043126-82043148 GCTGCTAGTGCGCACCGTGCTGG - Exonic
1138961932 16:62037495-62037517 ACGTCTAGTGCACACAGGGAAGG - Intergenic
1145902038 17:28495752-28495774 GTTGCTAGTGCACTCGGTGAAGG - Exonic
1148838708 17:50480437-50480459 GCTTCTAGAGTACAGCCTGAAGG + Intronic
1151024393 17:70660201-70660223 GGTACTAGTGTACACGGTGAGGG - Intergenic
1151059772 17:71078546-71078568 ACTTCTAGGGCACACCATTAAGG - Intergenic
1165426542 19:35748920-35748942 ACTTCAAGCGCACACCGGGAGGG - Intronic
925115197 2:1372643-1372665 CATTCTGGTGCTCACCGTGAAGG + Intergenic
930487383 2:52025729-52025751 TCTTCTATTGTACACCTTGAAGG + Intergenic
940391497 2:153137785-153137807 GCTTTTAGTGCAAACCCAGATGG - Intergenic
1172491009 20:35337886-35337908 GTTTCTAGAGGAGACCGTGACGG - Intronic
1174568114 20:51481559-51481581 GCTTCTAGTGCACACCGTGAAGG + Intronic
1180571720 22:16728925-16728947 TCTTCTAGTGGACACTTTGAGGG - Intergenic
957106473 3:75895548-75895570 TCTTCTAGTGGACACTTTGAGGG + Intergenic
962682030 3:137810316-137810338 GCTTCTAGTGCACAGCTTTGTGG + Intergenic
965703601 3:171483574-171483596 ACTTCCTGTGCACACCTTGAGGG + Intergenic
966316123 3:178647453-178647475 GATTCTAGTGCACTCTGTTAAGG - Intronic
970071921 4:12169480-12169502 GTTTCTGGTGCACACTGAGAAGG + Intergenic
973627840 4:52790683-52790705 TGTTCTAGTGCACACCTTAAAGG + Intergenic
975430132 4:74280098-74280120 GCTTCTAGTGGACATGGTGTCGG - Intronic
976077861 4:81320046-81320068 GCTACCAGTGCACAGAGTGAGGG + Intergenic
977864339 4:102005506-102005528 GGTTCTAGTGGACACAGTGTGGG + Intronic
985956484 5:3269592-3269614 CCTGGTAGTGCACACCGCGAGGG - Intergenic
997231789 5:132250825-132250847 GCTTGAAGTGCACACAGTGTTGG - Intronic
1000251342 5:159498488-159498510 GCCTCTAGTGCACATCTTTAGGG - Intergenic
1001377518 5:171276098-171276120 GCTACTGGTGCACAGCATGAAGG + Intronic
1014263174 6:119243881-119243903 GCTTTTATTGCACACCATGAAGG - Intronic
1015122960 6:129721332-129721354 GCTTCTTGTTCACACTGAGATGG - Intergenic
1017673735 6:156793248-156793270 CCTCCTGGTGCACACAGTGAAGG + Intronic
1020599940 7:10261454-10261476 GCTTCTTGTGCACTCTGTAAAGG - Intergenic
1022217647 7:28280224-28280246 GCTTGTAGTGCACACTCTGCAGG + Intergenic
1028985060 7:97003059-97003081 GCTTGTTGTTAACACCGTGAAGG - Intergenic
1032467009 7:132152369-132152391 GCCAGTCGTGCACACCGTGAGGG - Intronic
1040620882 8:49091181-49091203 GCTACTAGTTTTCACCGTGATGG + Intergenic
1048872542 8:138811625-138811647 GCTTCTTGTGCACACTGGAAGGG - Intronic
1051315351 9:15823283-15823305 GGTACAAGTGCACAACGTGAAGG - Intronic
1052245830 9:26333370-26333392 GCTTCCAGTGAACACAGTGTTGG - Intergenic
1056424000 9:86457959-86457981 ACTTCTACTGCAAACCCTGATGG + Intergenic
1061659521 9:132119606-132119628 GCTTCTAATGTACACCCTGCTGG - Intergenic
1062145205 9:134985235-134985257 TCTTCTCGTGCACTCAGTGATGG - Intergenic
1189893057 X:45625671-45625693 GCTACAAGTGCACAACGTGCAGG + Intergenic
1198145831 X:133856938-133856960 GCTTCTAATGGATACTGTGATGG + Intronic
1201542435 Y:15120785-15120807 GCTACTTGTGCACAACGTGCAGG + Intergenic