ID: 1174570178

View in Genome Browser
Species Human (GRCh38)
Location 20:51495845-51495867
Sequence CAGGTTTCCCACAGGGACAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 262
Summary {0: 1, 1: 0, 2: 2, 3: 23, 4: 236}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1174570178_1174570182 -10 Left 1174570178 20:51495845-51495867 CCTCTGTCCCTGTGGGAAACCTG 0: 1
1: 0
2: 2
3: 23
4: 236
Right 1174570182 20:51495858-51495880 GGGAAACCTGTGGATCAGAGCGG 0: 1
1: 0
2: 3
3: 94
4: 887
1174570178_1174570185 11 Left 1174570178 20:51495845-51495867 CCTCTGTCCCTGTGGGAAACCTG 0: 1
1: 0
2: 2
3: 23
4: 236
Right 1174570185 20:51495879-51495901 GGACTCCCATTTTTCCCAGGAGG 0: 1
1: 0
2: 0
3: 18
4: 155
1174570178_1174570186 14 Left 1174570178 20:51495845-51495867 CCTCTGTCCCTGTGGGAAACCTG 0: 1
1: 0
2: 2
3: 23
4: 236
Right 1174570186 20:51495882-51495904 CTCCCATTTTTCCCAGGAGGAGG 0: 1
1: 0
2: 1
3: 26
4: 243
1174570178_1174570184 8 Left 1174570178 20:51495845-51495867 CCTCTGTCCCTGTGGGAAACCTG 0: 1
1: 0
2: 2
3: 23
4: 236
Right 1174570184 20:51495876-51495898 AGCGGACTCCCATTTTTCCCAGG 0: 1
1: 0
2: 0
3: 3
4: 88
1174570178_1174570191 27 Left 1174570178 20:51495845-51495867 CCTCTGTCCCTGTGGGAAACCTG 0: 1
1: 0
2: 2
3: 23
4: 236
Right 1174570191 20:51495895-51495917 CAGGAGGAGGATGCTAAAGTAGG 0: 1
1: 0
2: 2
3: 24
4: 402

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1174570178 Original CRISPR CAGGTTTCCCACAGGGACAG AGG (reversed) Intronic
900494295 1:2969507-2969529 CAGGTGTCCCACAGGAAGAGTGG - Intergenic
900897776 1:5495835-5495857 CAGGGTTCCCACAAGGCCGGAGG + Intergenic
901345902 1:8542163-8542185 CAGGATTCCCAAAGAGGCAGGGG + Intronic
902630318 1:17700950-17700972 CAGCTTTTCCACAGGAAGAGCGG + Intergenic
903375536 1:22863439-22863461 CTGGATTCACAAAGGGACAGGGG + Intronic
903595490 1:24490662-24490684 CAGACTGCCCAAAGGGACAGTGG + Intergenic
907273268 1:53303169-53303191 CAGCTTTCCTACAGGGACTTTGG + Intronic
907488321 1:54792361-54792383 CAGCTTCACCACAGGGATAGAGG - Intronic
909927719 1:81458481-81458503 GAGATTTCCCACTGGGAAAGTGG - Intronic
912693618 1:111823315-111823337 ACGGTTTCTCACAGTGACAGTGG + Intronic
913099193 1:115547372-115547394 CAGATTTCCCAAAGGAACATTGG + Intergenic
913218077 1:116637173-116637195 CAGGATGTCCACAGGCACAGGGG - Intronic
915023822 1:152806966-152806988 CAGGTTGCCCAGAGCCACAGAGG - Intronic
917791896 1:178504362-178504384 CAGGTCTCCAACAGGGACAAAGG + Intergenic
918136783 1:181680906-181680928 CAGGTGTCACACAGGGACTCAGG + Intronic
918775287 1:188620859-188620881 AAGTTTTCCCACAAGGACTGGGG - Intergenic
918901255 1:190422015-190422037 CAAGTTTCCCAGAGTGACACTGG + Intronic
920433959 1:205936380-205936402 CAGGTTTCCCAGGGGGACAATGG + Intronic
923363957 1:233241012-233241034 CAGGCTTCCTCCAGGGACATGGG + Intronic
923778597 1:237001579-237001601 CATGTTGACCACATGGACAGTGG - Intergenic
924694332 1:246382990-246383012 CAGGTTTCCCCCATGGACCCGGG + Intronic
1062927701 10:1329437-1329459 CAGCCTTCGCACATGGACAGTGG - Intronic
1063030085 10:2225742-2225764 CAGTTTCCACACAGGAACAGGGG + Intergenic
1064222327 10:13451931-13451953 CAGCTTCCCCAAAGTGACAGTGG - Intronic
1065756993 10:28939833-28939855 CAGGACTCTCACACGGACAGAGG - Intergenic
1067433890 10:46264126-46264148 CAGGACACCCACAGGGGCAGGGG + Intergenic
1068629894 10:59288145-59288167 CTGGTCTCCCATAGGAACAGAGG + Intronic
1070760194 10:79019454-79019476 CAGGTGTCCAAGAGGGAAAGGGG - Intergenic
1072425235 10:95324468-95324490 GAGGCTTCCCAAAAGGACAGGGG - Intronic
1073882491 10:107999570-107999592 CATGTTTTCCACAGTGGCAGTGG - Intergenic
1073945098 10:108741079-108741101 CACGTTTTCCACAGGGACATGGG - Intergenic
1074401755 10:113147260-113147282 CATGTTGGCCACAGGGACTGGGG - Intronic
1075361901 10:121845718-121845740 CAGGTTTCTTACAGTTACAGTGG + Intronic
1076528065 10:131125025-131125047 CAGTTTTTCCACCTGGACAGTGG - Intronic
1076722505 10:132398878-132398900 CAGATTCCCCACAAGGACAAGGG - Intronic
1077468924 11:2747749-2747771 CTGGTTGCCCACAGGGAGTGGGG + Intronic
1079293117 11:19206771-19206793 GAGCTTTCCCGCAGGGACTGTGG + Intronic
1081583965 11:44371542-44371564 GAGGGTTGCCCCAGGGACAGAGG + Intergenic
1083935039 11:65865631-65865653 CAGAGTTCCCACAGGGAGGGAGG + Intronic
1084335922 11:68457813-68457835 CAGGTGTAGCACAGGGCCAGAGG - Intergenic
1084572511 11:69968156-69968178 CCGAGTTCCCACAGGGCCAGGGG - Intergenic
1085280144 11:75324883-75324905 GAGGTTTCTCCCAGGGACAGGGG - Intronic
1085600836 11:77854783-77854805 CAGAGTCCCCACTGGGACAGTGG - Intronic
1086279779 11:85171987-85172009 CAGCTGAACCACAGGGACAGTGG - Intronic
1087171047 11:95050558-95050580 CAGCTGTCCCACACGGACTGTGG + Intergenic
1089197363 11:116702068-116702090 GAGACTGCCCACAGGGACAGTGG - Intergenic
1089734484 11:120540260-120540282 CAGGTCTGGCAAAGGGACAGGGG + Intronic
1092212161 12:6653392-6653414 CAGGTCTACAACAGAGACAGAGG + Exonic
1092704608 12:11268726-11268748 CAGGTGTTCTACAGGGAAAGGGG + Intronic
1092984072 12:13828327-13828349 CAGAATTCCCACTGGGCCAGAGG - Intronic
1097749648 12:63337642-63337664 CAGGTTCCCCTCTGGGACAATGG + Intergenic
1102199880 12:111049868-111049890 CAGGTCTGCCACTAGGACAGGGG + Intronic
1102506517 12:113387766-113387788 CAGGCTTTGCACAGTGACAGAGG - Exonic
1104821062 12:131677906-131677928 CAGGGTCCCCACAGTGACCGCGG - Intergenic
1105435996 13:20378870-20378892 CACGTTCCCCACTGGGACATGGG - Intergenic
1105589382 13:21776850-21776872 CAGTGTTCCCACATGGAAAGGGG - Intergenic
1110328495 13:74244458-74244480 CAAGTTGCAGACAGGGACAGAGG + Intergenic
1112463748 13:99625215-99625237 CAGGTTCCCAGAAGGGACAGGGG - Intronic
1114440959 14:22747322-22747344 CAGGTTCCACACAGGAAGAGGGG + Intergenic
1118482102 14:66177464-66177486 CATGTTTCCCACAGGCACACAGG + Intergenic
1118547472 14:66907855-66907877 CAGGTTTCTCACTGTCACAGTGG + Intronic
1120219080 14:81712538-81712560 AAAGTATCCCACAGGGACAATGG - Intergenic
1121091606 14:91186845-91186867 CAGTTTTCCCACATGGAGAATGG - Intronic
1122809672 14:104281738-104281760 CACGCTTCCCCCAGGGGCAGGGG - Intergenic
1122989044 14:105228113-105228135 CCGGCTTCTCACTGGGACAGGGG + Intronic
1124650914 15:31473309-31473331 CAGCTTCCTCACAGGGTCAGGGG - Intergenic
1126579034 15:50226065-50226087 CAGAGTTCCCAAAGGTACAGTGG + Exonic
1128629832 15:69253324-69253346 CAGTGTTCCCACAGGGTGAGTGG - Intronic
1130152498 15:81322223-81322245 GAGGTTTCCCACCGGGAAACTGG + Intronic
1131076579 15:89499166-89499188 TAGGTTCCCCACAGGAGCAGTGG + Intergenic
1132287145 15:100671482-100671504 CAGTTCCCACACAGGGACAGTGG + Intergenic
1135269646 16:21057936-21057958 CAGGGTTCCCATGAGGACAGTGG - Intronic
1135990827 16:27217788-27217810 CAGGGTTGCCAGAGGGACACAGG - Intronic
1136139560 16:28279835-28279857 CCGGCTTCCAGCAGGGACAGCGG + Intergenic
1137768565 16:50996491-50996513 AAGCATTCCCACAAGGACAGGGG - Intergenic
1138594264 16:58021352-58021374 CAGCTTTCCCAGAGAGGCAGAGG + Exonic
1139685474 16:68599961-68599983 CAGGCTTCCCACAGGAAATGAGG + Intergenic
1139936943 16:70578356-70578378 CAGGTTTTCCTGAGGGACACAGG - Intergenic
1141384599 16:83608292-83608314 CAGTTTTCACAAAGGGACAAAGG + Intronic
1141766878 16:86064621-86064643 CAGGTTTCCCTCTGGGACTCAGG + Intergenic
1141863979 16:86737092-86737114 CAAGTTTTCCACAGGGCCATGGG - Intergenic
1142222227 16:88861228-88861250 CAGTTGTCCCAAAGGGGCAGAGG + Exonic
1142692859 17:1617292-1617314 CAGTCTCCCCACATGGACAGAGG - Intronic
1143279966 17:5746532-5746554 AGGGTTTCACACAGGTACAGAGG + Intergenic
1144774392 17:17777735-17777757 CAGTTTCCCCACTGGCACAGTGG - Intronic
1148859131 17:50594978-50595000 CTGATTTCCTACAGGGAAAGGGG - Exonic
1148900644 17:50873516-50873538 CAAGTTAATCACAGGGACAGGGG + Intergenic
1149876218 17:60235797-60235819 CAGGTTCCCCACAGGTAAAATGG + Intronic
1150679451 17:67272865-67272887 CAAGTTTGACACAGGGCCAGGGG + Intergenic
1151523492 17:74647834-74647856 CAGGACTCCCACAGAGCCAGTGG - Intergenic
1151961992 17:77410397-77410419 CAGGTTTCAGACAGGGGCCGTGG - Intronic
1152350187 17:79779796-79779818 CAGGTTTGCCACAGTGACGCAGG + Intronic
1152565920 17:81100436-81100458 CAGGTGTCCCACCGGGACTCCGG - Intronic
1152899635 17:82933005-82933027 CAGCTATCCCACCGGGCCAGGGG + Intronic
1153225350 18:2895646-2895668 CAGGTTGGCCACATGGAGAGAGG - Intronic
1153700219 18:7685212-7685234 CAGGGTTCAGACAGGGGCAGGGG - Intronic
1155044905 18:22095127-22095149 CAGGAATCCCTCAGGGACAGAGG - Intronic
1155272899 18:24158189-24158211 CAGCTGTCTCACAGGGAGAGAGG - Intronic
1156436640 18:37137762-37137784 TAAGTTTCCCACAGAGAAAGAGG - Intronic
1157307380 18:46526899-46526921 GGGGTTTCCAACAGGGAGAGGGG + Intronic
1157308022 18:46531063-46531085 AAGGTTTGCAAAAGGGACAGGGG - Intronic
1157523718 18:48362929-48362951 CATGTTTCCCAGCTGGACAGTGG - Intronic
1159212851 18:65349476-65349498 CAAGATTCCCACAGCGTCAGTGG - Intergenic
1160856721 19:1221127-1221149 CAGCTCTACCCCAGGGACAGAGG - Intronic
1161024893 19:2032245-2032267 CACGTGTCCCACCGGGTCAGGGG - Intronic
1161161692 19:2765278-2765300 CTCGTTTCCTACAGGGAGAGAGG + Exonic
1161965140 19:7543573-7543595 CAGTTTCCCCATATGGACAGTGG - Intronic
1162020019 19:7864067-7864089 CAGGCTTCCTTCTGGGACAGGGG + Intronic
1162835587 19:13315408-13315430 CAGTTTTCTCAAAGGGAAAGTGG + Intronic
1163726273 19:18924833-18924855 CGGTTTCCCCACATGGACAGTGG + Intronic
1166268858 19:41701382-41701404 CAGGTTCCCCTCAGGGACAGAGG - Intronic
1166364384 19:42271053-42271075 CAGGCTGCCCAGAGGGGCAGAGG + Intronic
1166829216 19:45628533-45628555 CAGGTTTCCACCAGGCGCAGTGG + Intronic
1167014755 19:46833716-46833738 CAGGTTTAAAACAGGCACAGTGG + Intergenic
1167257688 19:48441135-48441157 CAGGTGGACCACAAGGACAGGGG + Intronic
1167511423 19:49897215-49897237 CTTGATTCCCACGGGGACAGAGG + Intronic
925145950 2:1583449-1583471 CAGGCTTAGCACAGGGACTGGGG - Intergenic
926164050 2:10507195-10507217 CAGGGTTCCCACAGGGTCGGGGG - Intergenic
927712236 2:25333014-25333036 CTGGGTCCCCACATGGACAGGGG + Intronic
927968623 2:27289178-27289200 CAGGTTTCACACACTGACATTGG - Intronic
928059931 2:28101589-28101611 CAGGTTCCCCACATGGACTGGGG - Intronic
931516288 2:63052229-63052251 CAGGCTTCGCAGAGGGCCAGAGG - Intronic
931817543 2:65919687-65919709 CCGGTTCACCGCAGGGACAGAGG + Intergenic
932205545 2:69878224-69878246 CATGTTTGTCATAGGGACAGTGG + Intronic
935092030 2:99904731-99904753 CTCCTTTCCCACAGGGAGAGGGG + Intronic
935507302 2:103921534-103921556 CAGTTTTTCTACAGGGCCAGAGG - Intergenic
936373818 2:111924299-111924321 CAGTTTGCTCACAGGGAAAGTGG - Intronic
936479441 2:112871463-112871485 CAAGGTTCCTAAAGGGACAGTGG + Intergenic
937081283 2:119141809-119141831 CACGTTTCCTACAGGGCAAGTGG - Intergenic
937300496 2:120836548-120836570 AAGTTCTCCCACAGGGACACAGG - Intronic
941453788 2:165692114-165692136 AAGTTTTCCCCCAGGGAGAGAGG - Intergenic
944679524 2:202064480-202064502 CTGCTTTTCCACTGGGACAGAGG - Intergenic
945688333 2:213000563-213000585 CAGTTTTACTACAGGGACACAGG + Intronic
945924483 2:215789387-215789409 CAGGTTTCCGATAAGGTCAGAGG + Intergenic
947816573 2:233041415-233041437 CAGCTGCCCCACAGGGACATGGG + Intergenic
947938158 2:234025203-234025225 GAGGCTTCCTACAGGGACACAGG + Intergenic
948550929 2:238772681-238772703 CAGGGTCCCCACAGGCACGGAGG + Intergenic
948722318 2:239908843-239908865 CAGGTTTCCAACAGGGAGGTAGG - Intronic
948860445 2:240750268-240750290 CAGGTTGACCCCAGGGAGAGTGG + Intronic
1168846353 20:947179-947201 CAGGTATCCCCCAGGGCCAGGGG - Intergenic
1170975508 20:21160362-21160384 CAGGTTTCCCACAGGCAGCCTGG - Intronic
1172186772 20:33035815-33035837 CAGGCCTCCCATCGGGACAGTGG - Intronic
1174570178 20:51495845-51495867 CAGGTTTCCCACAGGGACAGAGG - Intronic
1176134874 20:63518122-63518144 CAGGCTTCCCACAGGGCGGGAGG - Intergenic
1177188772 21:17826201-17826223 CAAGTTTCCCAAAAGGAAAGTGG + Intergenic
1177359359 21:20048636-20048658 CAGGTCTGCCACGGCGACAGCGG + Intergenic
1180819384 22:18815257-18815279 CAGGATGTCCACAGGCACAGGGG - Intergenic
1181205609 22:21249702-21249724 CAGGATGTCCACAGGCACAGGGG - Intergenic
1181525679 22:23484380-23484402 CAGGCAACCCACAGGGAGAGAGG + Intergenic
1181890486 22:26058720-26058742 CAGGGATCCCACAGTGAGAGAGG - Intergenic
1182730369 22:32485174-32485196 CAGGTTTCCCAAAGGCACACAGG - Exonic
1183319954 22:37159043-37159065 CCTGTTTCCCACAGGAAAAGCGG - Intronic
1183326845 22:37199040-37199062 CAGGTTTCCCGCCGGGGCAGAGG - Intronic
1183333107 22:37231873-37231895 CAGGTAACCCTGAGGGACAGAGG - Intronic
1183831976 22:40423081-40423103 CAGGTCCCCCACACCGACAGTGG + Intronic
1184806414 22:46797352-46797374 CAGCATTCACAAAGGGACAGTGG + Intronic
1203221314 22_KI270731v1_random:45711-45733 CAGGATGTCCACAGGCACAGGGG + Intergenic
1203269512 22_KI270734v1_random:41110-41132 CAGGATGTCCACAGGCACAGGGG - Intergenic
950268331 3:11592415-11592437 CAGGGTTCCCTCAGGGATTGTGG - Intronic
950424868 3:12919713-12919735 CAGGGTTCCCACAGGGACTGAGG + Intronic
950490187 3:13299832-13299854 CAGGTTTCCTGCAGAGACAGAGG - Intergenic
950631350 3:14284155-14284177 GAGGTTTCCCAAAGGGAAACTGG - Intergenic
951639678 3:24822769-24822791 TAGGTTTCCCACTGTCACAGTGG - Intergenic
952558378 3:34559905-34559927 CAGGTGTCTCACAGGGCAAGAGG + Intergenic
952888019 3:38023573-38023595 TAGCTTACCCACAGGGTCAGCGG + Intronic
953109592 3:39921061-39921083 GAGGCTTCCCACAGGTAAAGGGG - Intronic
955095983 3:55798664-55798686 CAAGTTTTCCACAGCAACAGTGG + Intronic
956486762 3:69731263-69731285 CAGGAATCCCACTGGGACACAGG + Intergenic
958843099 3:99232621-99232643 GAGATTTCACACAGGGAAAGAGG - Intergenic
959069532 3:101689458-101689480 CACTGTTCTCACAGGGACAGAGG - Intergenic
959151892 3:102617961-102617983 CAGTTTTCCCAAAGGCTCAGAGG + Intergenic
961126390 3:124422265-124422287 CAAGTGTCGCACATGGACAGTGG - Intronic
961482418 3:127192743-127192765 CAGGAGGCCCACAGGGCCAGAGG - Intergenic
962378196 3:134876097-134876119 CACTTATCCCACAGGGACTGAGG - Intronic
963467863 3:145705032-145705054 CAGGCTTCCCATTGGGGCAGGGG + Intergenic
965456540 3:168908373-168908395 CAGTTCTCCCACGGGGGCAGAGG - Intergenic
965814205 3:172619858-172619880 CAGGTTTGCAACAGGGAGAGAGG + Intergenic
968074426 3:195808802-195808824 GGGGTTTCCCAGAGGGGCAGAGG + Intronic
968495220 4:911458-911480 CAGGTGGCCCACCGGGACAGTGG + Intronic
968763027 4:2452054-2452076 CAGGTTTTCCTGAGGGACAGTGG - Intronic
968855784 4:3120718-3120740 CAATTTTTCCACAGGGCCAGGGG - Intronic
969058026 4:4414132-4414154 CAGGTTCCCCACAGGGAGGAGGG + Intronic
969297406 4:6278099-6278121 CAAGTCTCCCTCAGGGAGAGGGG - Intronic
972302027 4:37793406-37793428 CAGTCTTCCCAAAGGCACAGAGG + Intergenic
973951130 4:56015475-56015497 CCTGTGTCCCACAGGGGCAGTGG - Intronic
974723670 4:65773245-65773267 GGTGTTTCCCACAGTGACAGAGG + Intergenic
975733159 4:77357081-77357103 CAGCCTTCTCACAGGCACAGAGG + Intronic
978292681 4:107163524-107163546 CAGGTTTCTCACTGGGGGAGTGG + Intronic
980758640 4:137199000-137199022 CAGGCTGTCCACAGGCACAGTGG + Intergenic
981364746 4:143889373-143889395 CTCCTTTCCCACTGGGACAGTGG - Intronic
981375246 4:144007644-144007666 CTCCTTTCCCACTGGGACAGTGG - Intronic
981385862 4:144129845-144129867 CTCCTTTCCCACTGGGACAGTGG - Intronic
984809918 4:183786409-183786431 CAGGTTTCCAAAAGGAAAAGAGG - Intergenic
985327724 4:188791040-188791062 CAGGTTATCCATAGGGACACGGG + Intergenic
988054827 5:26081117-26081139 CAGATTTCACACAGGAAAAGAGG + Intergenic
988935915 5:36082946-36082968 CAGAGCTCCCAGAGGGACAGTGG + Intergenic
989769473 5:45126674-45126696 CAGGTTTCCCACCGAAACAGAGG - Intergenic
993176384 5:84491319-84491341 CATCTTTCCCAGATGGACAGGGG + Intergenic
993866948 5:93207033-93207055 CAGGTTACCCACAAGGAAAAGGG + Intergenic
996478786 5:123949879-123949901 CATTTTTCCCACTGGGACTGGGG - Intergenic
996868990 5:128164574-128164596 CAGGTTTCCCAAAGGTAGAAAGG - Intronic
998176321 5:139904257-139904279 CAGGTTTCTCCCAGGGAAACCGG + Intronic
1000372239 5:160548087-160548109 CAGGATTCCCAAAGTAACAGTGG + Intergenic
1001607300 5:172970753-172970775 TTTTTTTCCCACAGGGACAGAGG - Intergenic
1006513598 6:34534282-34534304 CAGGCCTCCCTCAGGGCCAGGGG + Exonic
1007699090 6:43755529-43755551 CAGTTTTCCCACAGCTAGAGAGG + Intergenic
1012977674 6:105797388-105797410 CAGGTTTGCCTGAGGGACACAGG + Intergenic
1013316633 6:108949606-108949628 CAGTTTTCCAACCAGGACAGAGG - Intronic
1013384668 6:109614266-109614288 CAAGGCTCCCAAAGGGACAGAGG - Exonic
1013810554 6:114040041-114040063 CAGACTTGCCACAGGGACAGTGG - Intergenic
1014266599 6:119285074-119285096 CAGGTGTCACACATGGCCAGAGG + Intronic
1016234949 6:141853611-141853633 TAAGTTTCCCCCAGGGAAAGAGG - Intergenic
1016657330 6:146536360-146536382 CTTGTTTCCCACAGGGATATGGG + Intergenic
1016993390 6:149944608-149944630 CAGGTTTCCCATAAGCACAGTGG + Intronic
1017004942 6:150022922-150022944 CAGGTTTCCCATAAGCACAGTGG - Intronic
1017972770 6:159327423-159327445 CAGTTTTCCCACTGGTAGAGGGG + Intergenic
1019177479 6:170167561-170167583 CATGTTTCCCAAAGGGAGCGTGG - Intergenic
1019546895 7:1582228-1582250 CAGGCTTCCCTCAGGAACAAAGG - Intergenic
1021791425 7:24209791-24209813 CAGGTTGGCCACAGAGACATTGG - Intergenic
1023780691 7:43652298-43652320 CATGTTACCCAGAGGAACAGAGG - Intronic
1026768015 7:73172639-73172661 CAGGTTACCCAGAGGCCCAGGGG - Intergenic
1027044481 7:74982349-74982371 CAGGTTACCCAGAGGCCCAGGGG - Intronic
1027079158 7:75220011-75220033 CAGGTTACCCAGAGGCCCAGGGG + Intergenic
1027358940 7:77388392-77388414 TGGGTTTCCCTCAGGGACAGTGG + Intronic
1032425333 7:131818270-131818292 CAGGTTTCAGAAAGGGACAATGG + Intergenic
1033448104 7:141439403-141439425 CTGGTCTCCCACAGAGACAGAGG + Intronic
1033587725 7:142786866-142786888 CAGTGTTCACACAGTGACAGGGG - Intergenic
1034564776 7:151904395-151904417 CAGGATTCCCACAGGGCCCCGGG - Intergenic
1035240299 7:157524546-157524568 CAGGAGCCCCACAGGGACATTGG - Intergenic
1035286504 7:157810457-157810479 CAGGCTCTCCACGGGGACAGCGG + Intronic
1035286617 7:157810806-157810828 CAGGCTTTCCACGGGGACGGCGG + Intronic
1035373606 7:158394147-158394169 CAGGTGTCCGTCGGGGACAGAGG - Intronic
1036008281 8:4692150-4692172 CTGGTTTCCAGAAGGGACAGGGG - Intronic
1039583184 8:38683464-38683486 GAGGGGTCCCAGAGGGACAGGGG - Intergenic
1042639942 8:70922681-70922703 CAGGATGCTCACAGGGACAGAGG + Intergenic
1044849715 8:96416790-96416812 CAGGTTTCCTACAGTGACTTTGG - Intergenic
1045851678 8:106707221-106707243 CAGGTTGCCCTAAGGTACAGCGG - Intronic
1046405890 8:113771578-113771600 CAGGAATCCCACAGAGAAAGAGG - Intergenic
1047194184 8:122706509-122706531 CATGTGTCCCAGAGTGACAGTGG + Intergenic
1048184666 8:132228907-132228929 AAGGTTTGACACAGGGAGAGAGG + Intronic
1049206321 8:141365302-141365324 TTGGTTCCCCACAGGCACAGTGG - Intronic
1049463458 8:142740477-142740499 CAGCTGTCCCAAGGGGACAGTGG + Intergenic
1049513776 8:143043065-143043087 CTGGTGACGCACAGGGACAGAGG + Exonic
1049705789 8:144041381-144041403 CAGGGGTCCTGCAGGGACAGGGG + Intronic
1049744549 8:144257708-144257730 CAGGTGTCCCACAGGGCCCCTGG - Intronic
1050666551 9:7944408-7944430 CAGGTTTTCTACAGAAACAGAGG - Intergenic
1051111567 9:13643931-13643953 TAGGGTACCCATAGGGACAGAGG + Intergenic
1055172098 9:73271261-73271283 CAGGTTTCCCAGTTGGACTGAGG - Intergenic
1056272004 9:84955551-84955573 CAGGGGTCCCGCAGGGAAAGAGG - Intronic
1056838119 9:89974427-89974449 CAGGTGCCCTGCAGGGACAGTGG + Intergenic
1060901157 9:127259390-127259412 CAAGTTTCCCACAGGCAACGTGG - Intronic
1061144385 9:128788603-128788625 GGGGTTTCCCAGAGGGGCAGTGG + Intronic
1062227012 9:135457931-135457953 CAGTTTCCCTACAGGCACAGTGG - Intergenic
1062228446 9:135467188-135467210 CAAGTTCCCCACAGTGAGAGTGG + Intergenic
1062333598 9:136055294-136055316 CAGGATTCACACAAGGACACAGG + Intronic
1186122187 X:6375096-6375118 CAGGTTTCCAGTAGGGACTGTGG - Intergenic
1186205590 X:7196901-7196923 AAGGATTCCAACAGGGCCAGTGG - Intergenic
1187221891 X:17335699-17335721 CAGGATTCCAACCGAGACAGTGG + Intergenic
1189494937 X:41500139-41500161 CAGGCTTCCCACAGGGTGGGAGG - Intergenic
1190317052 X:49157742-49157764 CAGTTTCCCAATAGGGACAGTGG - Intergenic
1197278181 X:124504490-124504512 CAGGTTTCCAAGAGGGAAAATGG - Intronic
1198305654 X:135380156-135380178 CAGGTTTCCCAAAGGACAAGAGG - Intergenic