ID: 1174570309

View in Genome Browser
Species Human (GRCh38)
Location 20:51496714-51496736
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1024
Summary {0: 2, 1: 10, 2: 62, 3: 224, 4: 726}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1174570309_1174570312 -4 Left 1174570309 20:51496714-51496736 CCAATAAGTGGCAGAACCAGGAT 0: 2
1: 10
2: 62
3: 224
4: 726
Right 1174570312 20:51496733-51496755 GGATTCAAACCCAGGTCATCCGG 0: 3
1: 10
2: 72
3: 268
4: 967

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1174570309 Original CRISPR ATCCTGGTTCTGCCACTTAT TGG (reversed) Intronic
900865835 1:5268000-5268022 ATCCTAGTTCTGACACTTGCAGG + Intergenic
901002794 1:6156918-6156940 ATCCTGGCTCTGCCACATACCGG + Intronic
901299090 1:8185643-8185665 ATCCCGGTTCTGTCACTTACTGG - Intergenic
901518813 1:9768087-9768109 ATCGTAGCTCTGCTACTTATTGG - Intronic
901728139 1:11258407-11258429 ACCCTGTGTCTGCCACTTACTGG - Intronic
902136253 1:14308609-14308631 ATCCTGGATCTGCCAAGTACTGG + Intergenic
902181757 1:14694667-14694689 AGCCTGACTCTGCTACTTATAGG + Intronic
902238593 1:15073688-15073710 CTCCTGCTTCTGCCACTTCCTGG - Intronic
902408667 1:16200214-16200236 ATCCCAGTTCTGCCGCTTACTGG + Intronic
902556807 1:17251642-17251664 ATCCTGGCTCTGCCACTCACTGG - Intronic
902687788 1:18090147-18090169 ATCCTTTCTCTGCCACTTCTTGG + Intergenic
902743545 1:18457524-18457546 ATCTTGGTTTTGCCACTTTCAGG + Intergenic
902773552 1:18660211-18660233 ATCCTGGCTCTGCCACTTGCTGG + Intronic
902785716 1:18731426-18731448 ATCCCAGCTCTGCCACTTACCGG + Intronic
902894632 1:19470735-19470757 GACCTGACTCTGCCACTTATTGG + Intronic
903004342 1:20288843-20288865 ATCCCAGCTCTGCCACTTCTTGG + Intergenic
903173491 1:21567635-21567657 ATCCTGATGCTGCCACTTCCTGG + Intronic
903288358 1:22291187-22291209 GTCCTGGCTTTGCCATTTATTGG + Intergenic
903447867 1:23433792-23433814 ATCCTGGCTCTGCCATTTTCTGG + Intronic
903666807 1:25013025-25013047 ATCCCAGCTCTGCCACTTACCGG - Intergenic
904291637 1:29489844-29489866 ATCCCAGTTCTGCCACTTACTGG + Intergenic
904316366 1:29668618-29668640 ATCCTGGCTCTGTCACCTACTGG - Intergenic
904491231 1:30860633-30860655 ATCCTCATTCTGCCACGTACTGG + Intergenic
904501590 1:30915807-30915829 ATTCTGGGTCTGCCACTTCCAGG + Intergenic
904608605 1:31712878-31712900 ATCCTGGCTCTGCTACTTCCTGG + Intergenic
904705157 1:32384383-32384405 ATCCTTGCTCTACCACTTGTTGG + Intronic
904786100 1:32984203-32984225 ACCCTGGCTCTGCCAGTCATTGG - Intergenic
904791398 1:33024638-33024660 AACCTGGCCCTGCCACTTACTGG + Intronic
904839191 1:33360445-33360467 ATCTTGGCTCTGACACTGATAGG + Intronic
904894489 1:33803997-33804019 ATCCCAGTTCTGCCACTTACTGG + Intronic
905542578 1:38772156-38772178 AACCTGGTTCTGCCACTTCCTGG - Intergenic
905586652 1:39124872-39124894 ATCCTGATTCTGCCACTGACTGG - Intronic
905766124 1:40602594-40602616 ACCCTGGCTCTGCCACTTACTGG + Intergenic
905801959 1:40849970-40849992 GTCCTGGCTCTGTCACTTACTGG - Intergenic
905887864 1:41501457-41501479 ATCCGGCTTCTGCAACTTCTGGG - Intergenic
905913170 1:41667678-41667700 GTCCTGGTCCTGACACTTACTGG + Intronic
905944090 1:41887468-41887490 GTCCTGGGTCTGCCACTTCCTGG - Intronic
906065182 1:42975420-42975442 ATTATGACTCTGCCACTTATGGG + Intergenic
906163873 1:43671368-43671390 ATCCTGGCTCTGTCACTGAGGGG - Intronic
906250882 1:44309964-44309986 ATCCTGGCTGTGTCACTGATGGG + Intronic
906261818 1:44397948-44397970 ATCCTATTTCAACCACTTATTGG - Intergenic
906315653 1:44784985-44785007 ACCCTGTCTCTGCCACCTATAGG - Exonic
906477380 1:46178774-46178796 ATCCTGGCTCTGCCACTTACAGG + Intronic
906706230 1:47896741-47896763 ATCCTGGTACTGCCACTTCTTGG + Intronic
906780775 1:48571214-48571236 ATCCTAGTTTTGCCACTTCCAGG - Intronic
906912782 1:49973016-49973038 GTCTTGGTTCTGCCACTTAATGG - Intronic
907173290 1:52492596-52492618 ATTTTAGTTCTGCCACTTACTGG - Intronic
907264440 1:53248519-53248541 ATTCTGGTTCTGCCACTTCCTGG + Intronic
907286617 1:53384499-53384521 ATCCTGGCTTTCCCACTTACCGG + Intergenic
907307709 1:53522553-53522575 ACCCTGGCTCTGGCACTTCTGGG + Intronic
907374365 1:54023679-54023701 ATTCTGGCTCTGCCACTTTGTGG - Intergenic
907391519 1:54161346-54161368 ATCCTGGTTCTGCCACTTAGAGG - Intronic
907487591 1:54788236-54788258 GTCCTGGTTCTGCCCCTGACTGG + Intronic
907759600 1:57344145-57344167 AACTTGGTTCTGCCATTTACTGG - Intronic
907847688 1:58224149-58224171 ATCCTTGCTCTTCCAATTATAGG + Intronic
908025767 1:59950193-59950215 ATCCTGTTTCTCCTACTCATTGG - Intergenic
908124712 1:61018864-61018886 ATCCTGGTTCTGCCACTTACTGG - Intronic
908418074 1:63932729-63932751 ATCCTGCCTCTGTCACTTACTGG - Intronic
908449324 1:64236058-64236080 ATCCTGGGTCTGCCATTTACTGG + Intronic
908471719 1:64450762-64450784 TTCCAGGTTCTGCTCCTTATAGG - Intergenic
908528370 1:65009800-65009822 ATCCCAGCTCTGCCACTTACTGG - Intergenic
908816717 1:68042724-68042746 ATCCTGGCTCTGCTACTTACCGG + Intergenic
908833965 1:68209877-68209899 ACCCCAGTTCAGCCACTTATTGG - Intronic
909202130 1:72704041-72704063 CTCTTGATTCTGCCACTTACTGG + Intergenic
909494133 1:76259361-76259383 ATCCTGGTTCTGTCACTGAGTGG + Intronic
910213517 1:84818029-84818051 ATCCTGGCTCTTCCACTGATCGG + Intronic
910259606 1:85282894-85282916 ATCCCGGTTCTGCTACTTGGTGG - Intergenic
910419268 1:87039676-87039698 ATCCTGATTTTACCACTTACTGG + Intronic
910438283 1:87227663-87227685 GCCCTGGTTCTGGCACTTACAGG + Intergenic
911078192 1:93900514-93900536 TTCCTGGTTCAACCACTTACTGG + Intronic
911468041 1:98279804-98279826 ACAGTGGTTCTGCCACCTATTGG + Intergenic
911705128 1:101002346-101002368 ATTCTGGCTCTGCAACTTGTTGG + Intronic
911754887 1:101542296-101542318 ATCCTGCTTCTGTCACTTGCTGG - Intergenic
911790734 1:102012699-102012721 ATCCTGAATCTGCCATTCATTGG - Intergenic
912299378 1:108498435-108498457 ATCCCGGCTCTGCCACTTACTGG - Intergenic
912493156 1:110073525-110073547 ATTCTGGTTCTGGCACTAACTGG - Intronic
912806733 1:112762667-112762689 AATCTGGTTCTGCCACTTGCCGG + Intergenic
912823946 1:112888497-112888519 AGCCTGGTTCTACCACTGACTGG - Intergenic
913094048 1:115499401-115499423 ATCCTGATTCTGCCTTTAATTGG + Intergenic
913225079 1:116691950-116691972 AGCCTGGCTCTGCCACTTTCTGG + Intergenic
913278569 1:117163262-117163284 GTCCCAGCTCTGCCACTTATTGG + Intronic
913380743 1:118207846-118207868 ATCTTGGTTCTGCCACTCCTTGG + Intergenic
914199821 1:145475020-145475042 ATCCTCATGCTGCCCCTTATAGG - Intergenic
914232984 1:145781728-145781750 ATCCTGTGTCTGCCACTTATTGG - Intronic
914478940 1:148048155-148048177 ATCCTCATGCTGCCCCTTATAGG - Intergenic
914779526 1:150772473-150772495 GTCTTGGTTCTGCCATCTATTGG + Intergenic
914877260 1:151521391-151521413 ATCCTGGTTCTGTTACTTGTTGG + Intronic
914878813 1:151532205-151532227 ATCCTGGCTCTACCACTTACTGG - Intronic
915169227 1:153966306-153966328 ATCTTGGTTCAGCTACTTACAGG + Intronic
915453316 1:156021908-156021930 ATCCCAGTTCTGTCACTTACTGG + Intergenic
915537621 1:156546729-156546751 CTCCTGGTCCTACCACTTCTGGG - Intronic
915668933 1:157470733-157470755 ACTCTGGTTCTGCCCCTTATTGG + Intergenic
915938814 1:160105437-160105459 ATCCTAGGTCTACCACTAATTGG - Intergenic
916185667 1:162130282-162130304 ATCCTAGTTCTGCCACTTACAGG - Intronic
916193702 1:162203668-162203690 ATCCCAGTTCTGCCACTCTTAGG + Intronic
916382267 1:164225296-164225318 ATCTCAGTTCTGCCACTTAATGG + Intergenic
916515765 1:165515097-165515119 ATCCTGGTCTTGCCACATAGAGG + Intergenic
917626312 1:176850070-176850092 ATCCTGGCTCTGCCACTTACTGG - Intergenic
918150685 1:181795867-181795889 GTCCCAGTTCTGCCACTTAATGG - Intronic
918429051 1:184439305-184439327 GTCCTGGCTCTGCCACTCATTGG + Intronic
918712873 1:187752828-187752850 ATCCAAGTTCTGACACTTACAGG - Intergenic
918984448 1:191605696-191605718 ATCCTGGCTTTGCTACTTACTGG + Intergenic
919118091 1:193306486-193306508 GTCCTGGCTTTCCCACTTATTGG - Intergenic
919438550 1:197596010-197596032 ATCCCAGCTTTGCCACTTATTGG - Intronic
919572394 1:199265039-199265061 ATCCTGGTTCTACCACTTACTGG + Intergenic
919679814 1:200423298-200423320 ATCCTGCTTTTGCCACTTCCTGG - Intergenic
919823470 1:201487561-201487583 ATCCTAGTTTTGCCATTTATTGG - Intronic
920113827 1:203605606-203605628 ATCCTGGCCCTGCCACTGATGGG + Intergenic
920211640 1:204332786-204332808 ATCCTGGCTCTGCCCCTTGCTGG + Intronic
920259091 1:204676900-204676922 ATTCTGGCTCTGCCACTTGCTGG + Intronic
920447498 1:206029874-206029896 GTCCTGGCTCTGCCACTAACTGG + Intergenic
920694026 1:208168051-208168073 ATCCTGGTTTTGCTACTCATGGG + Intronic
920756008 1:208733743-208733765 GTTCTGATTCTGCCACTTGTTGG - Intergenic
921324672 1:213978993-213979015 ATTCTGGCTGTGCCACTTACTGG + Intergenic
921836862 1:219787300-219787322 ATCCTGGTGCCACCACTTACTGG + Intronic
922852783 1:228747937-228747959 ATTCTGGCTCTGCCACTTACTGG + Intergenic
922870360 1:228897706-228897728 ATCCTGGCTCTTCCTCTTAGTGG - Intergenic
923466812 1:234255582-234255604 ATCTTGGTTCTTCCAATTTTTGG - Intronic
923872154 1:238007273-238007295 ACTCTGGTTTTGCTACTTATGGG - Intergenic
924327461 1:242910225-242910247 GTGCTGGTTCTACCTCTTATTGG + Intergenic
1064391671 10:14947534-14947556 ATCCTGGTCCTGCCACTTACTGG + Intronic
1065412701 10:25447353-25447375 ATATTGGCTCTGCCACTTACTGG - Intronic
1065861190 10:29873589-29873611 ATCCTGGGTCTCCCACTCCTCGG + Intergenic
1066414593 10:35209057-35209079 ATCCTGGTTCTGCCCAGTTTGGG - Intronic
1067091497 10:43267819-43267841 AGCCTTGCTCTGCCACTTATAGG - Intergenic
1067197363 10:44133640-44133662 ATCATGGCTCTGCCACTTATTGG - Intergenic
1067261788 10:44699447-44699469 GTCCTGGTTCTGTCACTAACCGG + Intergenic
1067543988 10:47178679-47178701 ATCCTGAATCTACCACTTAGTGG + Intergenic
1067893852 10:50159123-50159145 AACTTGGTTATGCCACTCATTGG - Intergenic
1067954992 10:50781144-50781166 AACTTGGTTATGCCACTCATTGG + Intronic
1068040014 10:51812018-51812040 ATCCTGGTTTCACCATTTATAGG + Intronic
1068340421 10:55694971-55694993 GTCCAGGTTCTGCCATTTAGTGG + Intergenic
1068581464 10:58745261-58745283 ATGCTGGTTCCGCCACTTATTGG + Intronic
1068718187 10:60211419-60211441 ATCCTTGTTCTGCCACTAATTGG + Intronic
1068842510 10:61631185-61631207 ATCCTTCCTCTGCCACTTACTGG + Intergenic
1069207941 10:65716368-65716390 ATTCTGGATCTGCCAGTGATAGG - Intergenic
1069410729 10:68150704-68150726 GTCCTGATTCTGCCACTAACTGG - Intronic
1069549341 10:69351717-69351739 ATGCTGACTCTGCCACTTACTGG + Intronic
1069881466 10:71596350-71596372 ATCCTGGCTCTGCCACTTCTTGG - Intronic
1069883970 10:71611665-71611687 ATCATGGGTCTGCTACTTACTGG - Intronic
1070366807 10:75744651-75744673 ATTCTGTTTCTGCCACTAATGGG - Intronic
1070390534 10:75966751-75966773 ATCATGGCTCTGCTATTTATTGG + Intronic
1070485047 10:76922296-76922318 ATCCTGGTTCTGCTGCTAACTGG - Intronic
1070689035 10:78511174-78511196 GTCCTGGCTCTGCCACTTAGAGG - Intergenic
1070773264 10:79095100-79095122 ATCCTGTGTCTTCCACTTGTGGG + Intronic
1070791040 10:79189581-79189603 ATCCTGGCTCTGACACTTGCTGG - Intronic
1071061614 10:81576621-81576643 TTCATGGTTTTGCCACTTCTTGG - Intergenic
1071276831 10:84063331-84063353 ATCTTGCCTCTGCCTCTTATTGG + Intergenic
1071291661 10:84193630-84193652 TTCCTGGTTGGGCCATTTATGGG - Intergenic
1071463455 10:85919753-85919775 ATCCCAGTTCTGCCACTTCCTGG + Intronic
1072246941 10:93552336-93552358 GTCCTGGTTTTGTCACTAATTGG - Intergenic
1072436995 10:95422952-95422974 ATCCTGGGTCTACCACCTAAGGG + Intronic
1072695292 10:97598982-97599004 CTCCTTGTTCTGCCTCTTCTGGG + Intronic
1073038002 10:100577751-100577773 TTCCTGGATCTTCCCCTTATTGG - Intergenic
1073071521 10:100797258-100797280 AATTTGGCTCTGCCACTTATTGG + Intronic
1073084760 10:100881025-100881047 ATCCTGGCTCTGCCACTCACTGG - Intergenic
1073107185 10:101038971-101038993 TTCCTGATTCTGCCACTTACTGG + Intronic
1073446382 10:103582937-103582959 ATCCTGGATCTGCCACATGGCGG + Intronic
1073471999 10:103728174-103728196 GTCCTGGCTCTGCCATTTATGGG + Intronic
1073677020 10:105659526-105659548 TTCATGTTTTTGCCACTTATAGG + Intergenic
1074164510 10:110863240-110863262 ATCCTAGTTGTGCTACTAATTGG - Intergenic
1074262466 10:111868253-111868275 ATTCTGATTCTCCCACTTATTGG + Intergenic
1074405338 10:113176516-113176538 ATCCCAGATCTGCCACTTTTTGG - Intergenic
1074893901 10:117758144-117758166 ATCCTGGTTCTGCCACCTACTGG + Intergenic
1074987162 10:118668730-118668752 ATCGTGGTTCTGCCACCTACTGG + Intergenic
1075088176 10:119428062-119428084 GTCCTGATTCTGCCAATTACAGG + Intronic
1075185701 10:120254973-120254995 ATCCTGGCTCTGCCAATACTAGG + Intergenic
1075615172 10:123885402-123885424 AGTCTGGTTCTGCCACTCATGGG - Intronic
1076767646 10:132645260-132645282 TTCCCGGCTCTGCCACTTAGTGG + Intronic
1076990387 11:270603-270625 CTCCTGGCTCTGCCACTCACTGG - Intergenic
1077776738 11:5280404-5280426 AGCCTGATTCTGCCGCTTCTAGG + Intronic
1078042982 11:7885536-7885558 ATCCAGGATGTGCCAATTATTGG - Intergenic
1078472702 11:11604498-11604520 ATCCTGGTGCTGCCTCTTACTGG - Intronic
1078483555 11:11701414-11701436 GTCCTGGCTCTGCCATTTACAGG - Intergenic
1078873731 11:15373165-15373187 ATCCTAATTCTGCCACTGATTGG - Intergenic
1079099220 11:17530400-17530422 ATCCTGGCTCTGCCACTTACTGG + Intronic
1079305532 11:19317993-19318015 ATCCTAGCTCTGCCACTTACTGG + Intergenic
1079475819 11:20828084-20828106 ATCTTGGATCTACCACTTACTGG + Intronic
1079697668 11:23503083-23503105 ATCCCAGCTTTGCCACTTATTGG + Intergenic
1079721777 11:23824874-23824896 ATCCCAGTTCTACCACTTGTTGG + Intergenic
1079932047 11:26576178-26576200 ATCCTGGTTTTGCCACTTAATGG + Intronic
1080234289 11:30051147-30051169 ACCCAGGTTTTGCCACTTACTGG - Intergenic
1080263497 11:30376103-30376125 CTCCTGGCTTTGCCACTTACTGG - Intergenic
1080308930 11:30867296-30867318 ATCCCAGTTCTGCCACTTATTGG + Intronic
1080684058 11:34501100-34501122 CTCCTAGCTCTGCCACTTACGGG - Intronic
1080857142 11:36122052-36122074 ATCCTGGCTCTGCCATTTACTGG - Intronic
1080866888 11:36203399-36203421 ATCCTGGCTCTACGATTTATTGG - Intronic
1081655351 11:44853618-44853640 ATCCTGGCTCTACCAGTTATTGG - Intronic
1081670086 11:44937866-44937888 AGCCTGGTCCTGCCACTTACCGG + Intronic
1081755238 11:45539617-45539639 GTCCTGGCTCTGCCTCTTATTGG + Intergenic
1081912905 11:46711579-46711601 GTCCTGGTTCTGCTACTGACTGG - Intergenic
1081954772 11:47081508-47081530 ATCTGAGCTCTGCCACTTATTGG - Intronic
1082027163 11:47581101-47581123 ATCTTGGTTCTGCCACTAAATGG + Intronic
1082828064 11:57595656-57595678 ATCCTGGCTCTGTCACTTACTGG + Intergenic
1082864351 11:57884982-57885004 ATCCTGGTTCTGATATTTATTGG + Intergenic
1083059530 11:59855352-59855374 TTCCTGGTTCAGCCACTCACAGG - Intronic
1083257146 11:61503534-61503556 ATCCTGGCTCCGCCCCTTACCGG + Intergenic
1083295807 11:61715092-61715114 GTCTTGGCTCTGCCACTTACTGG - Intronic
1083379649 11:62254902-62254924 ATCCTGGTTCTGCCTCTTCCTGG + Intergenic
1083634020 11:64110480-64110502 ATCCTGCCTCTGCCACTTTCAGG - Intronic
1083676806 11:64330578-64330600 ATCTTGGCTCTGCCACTTCCTGG + Intergenic
1083709671 11:64540445-64540467 ACCCTGGCTCTGCCACTCACCGG - Intergenic
1084033847 11:66496132-66496154 ATCCTGGCTCTGCCACTTAGTGG - Intronic
1084055659 11:66630784-66630806 ATCCTGGCTCTCCCTCTTCTTGG + Intronic
1085043088 11:73338286-73338308 ATCCTGGCTTGGCCACTTACTGG - Intronic
1085074198 11:73575120-73575142 ATCTTGGCACTGCCATTTATTGG - Intronic
1085299996 11:75452266-75452288 ATCCTGGCTCTGCTACCTACTGG + Intronic
1085311035 11:75516835-75516857 ATCCTGGCTTTGTCACTTACTGG - Intronic
1085718983 11:78896793-78896815 ACCCTGGTTCTGCCACTTACTGG + Intronic
1085770416 11:79320588-79320610 AACCTGGCTCTGCCATTTACTGG - Intronic
1085840854 11:80010174-80010196 ATCCTGGCTCTGCCACTTAGAGG + Intergenic
1086095423 11:83045604-83045626 ATCCTGACTCTACCACTTATTGG + Intronic
1086141915 11:83508786-83508808 ATCCCAGTTCTGCCACTTGCCGG - Intronic
1086633666 11:89055218-89055240 ATCCTGGCACAGCCATTTATTGG + Intronic
1087008184 11:93489154-93489176 ATCCTAGTTCTGCCGTTTATCGG + Intronic
1087104940 11:94399455-94399477 ATCCTGGCTCTGCCAACTACTGG + Intronic
1087658815 11:100961259-100961281 ATCCTAGCTCAGCCACTTACAGG + Intronic
1088050116 11:105502977-105502999 ATCCAAGTTCTACCATTTATAGG - Intergenic
1088148645 11:106716436-106716458 ATCCTGGCTCTACTACTTAACGG + Intronic
1088533451 11:110835569-110835591 ATCCTGACTCTGCAACTAATTGG + Intergenic
1088664817 11:112084143-112084165 GTCTTGGTTCTGCCACTCATTGG + Exonic
1088699379 11:112398333-112398355 CTCTTGGTTCTGCTGCTTATTGG + Intergenic
1089096015 11:115920666-115920688 ATTCTGGCTCTACCATTTATTGG - Intergenic
1089258004 11:117204193-117204215 ATCCTGGTTCCTCCTCTTCTAGG + Exonic
1089283910 11:117393608-117393630 ATCCTAGCTCTTCTACTTATTGG - Intronic
1089488126 11:118862961-118862983 ATCCCAGTTCTGCTACTTATTGG + Intergenic
1090006888 11:123010727-123010749 ATCCCAGTTCTGCTATTTATTGG - Intergenic
1090131120 11:124143042-124143064 AATCTGGCTCTGCCACTGATGGG - Intronic
1090233518 11:125128007-125128029 ATCCTGGCTCTACCCCTTACTGG + Intergenic
1090328860 11:125913760-125913782 AACCTGGGCCTGCCACTTCTGGG + Intronic
1090504944 11:127300979-127301001 ATCCTGGTTTTCTCACTTATTGG + Intergenic
1090571144 11:128047910-128047932 ATTCTGGTTCTACCACTGAATGG + Intergenic
1090867198 11:130711511-130711533 ATTTTGGTTCTACCACTTAGTGG + Intronic
1090936359 11:131346261-131346283 ATCCTGACTCTTCCATTTATTGG + Intergenic
1091055016 11:132409740-132409762 ATTCTGATTCTGCCACGTACTGG - Intergenic
1091415583 12:280272-280294 ATTCTGGATCTTCCATTTATTGG + Exonic
1091910220 12:4224564-4224586 ATCCTGGCTCTCCCACTCGTTGG + Intergenic
1091914208 12:4256505-4256527 ATCCTGGCTCTACCACTTATTGG - Intergenic
1092119292 12:6032672-6032694 ATCTTGATTCTGCCACTTATTGG + Intronic
1092158443 12:6300826-6300848 ATCTTGGTTTTGCTGCTTATGGG - Intergenic
1092182698 12:6457051-6457073 ACCCTGGTTGTTCCACTTACTGG - Intronic
1092306196 12:7303746-7303768 GTCCTGGTTCAGCCACTTTCCGG - Intergenic
1092476369 12:8822397-8822419 ATACTGGTTCAGCCAGTTTTGGG - Intergenic
1093051328 12:14508210-14508232 AGCCTGGTTCTGCCATTATTAGG + Intronic
1093718264 12:22408788-22408810 GTACTGGTTCTACCACTTACTGG - Intronic
1093987782 12:25556387-25556409 ATCTTGGCTCTGCCATTTACTGG - Intronic
1094078342 12:26503607-26503629 GTCTGGGTTCTTCCACTTATTGG + Intronic
1094172822 12:27511930-27511952 GTACTGGTTCTTCCACTTAGTGG + Intergenic
1094358430 12:29603514-29603536 GTCTTGGTTCTGCCATTTATTGG - Intronic
1094464597 12:30738372-30738394 ATCTTGGCTCTACCACTTACTGG + Intronic
1094531032 12:31275131-31275153 ATCCTGGTTTTGCTACTTACTGG - Intergenic
1095635907 12:44433445-44433467 ATCCTGGTCCTACAACTTTTGGG - Intergenic
1096475935 12:51908812-51908834 ATCCTGCCTTTGCCACTTAGAGG - Intronic
1096600579 12:52725736-52725758 GGCTTGGCTCTGCCACTTATTGG - Intergenic
1096622532 12:52873554-52873576 CTCCTGGTTCTGCCTCTTACTGG - Intergenic
1097023760 12:56038877-56038899 ATTCTGGTTCTGTCACTTACTGG - Intergenic
1097262996 12:57729963-57729985 ATCCTGGTTCTGCCACTTACTGG + Intronic
1097840956 12:64320675-64320697 ATCCTGGCTCTGCCACTTAATGG + Intronic
1097847082 12:64377946-64377968 ATTCTGGTTCTGCCACTTAATGG + Intronic
1098055461 12:66500251-66500273 TTCCTGGCTCTGCAACTTACTGG - Intronic
1098141504 12:67454432-67454454 ATCCTGGCACTGCCACTTGTTGG - Intergenic
1098234297 12:68403686-68403708 ATCCTTGCTCTGTCACTTACTGG - Intergenic
1099087705 12:78265976-78265998 ATCCAAGTTCTGTAACTTATTGG + Intergenic
1100079397 12:90829152-90829174 ATCCCAGTTCTGCCACTGACTGG + Intergenic
1100273226 12:93046239-93046261 ATCACTGCTCTGCCACTTATTGG + Intergenic
1100366933 12:93930272-93930294 ATCTTGGTTCTGCCACTTCTTGG - Intergenic
1100476496 12:94940259-94940281 ATCCTGCTTCTTCCACTTACTGG + Intronic
1100673506 12:96841824-96841846 TTCTTGGTTCCGCCACCTATTGG + Intronic
1100757038 12:97762833-97762855 AACCTGGCTCTACCACTTACTGG - Intergenic
1101078931 12:101161767-101161789 ATCTTGGTTCTGCCCTTTAGGGG - Intronic
1101337874 12:103812701-103812723 ATCCTGGTTCTGTCTCCTACTGG + Intronic
1101406784 12:104435796-104435818 TTCCTAGTTCTACCACTTACTGG - Intergenic
1101646960 12:106640246-106640268 TTCCTGCCTCTGCCACTGATTGG - Intronic
1101792194 12:107937806-107937828 ATCCCAGTTCTGCCATTTAATGG - Intergenic
1101884642 12:108651559-108651581 ACTCTGGTTCTTCCACTCATAGG + Intronic
1102203807 12:111076475-111076497 ATCCCGGCTCTGCCACTTCCTGG - Intronic
1102241116 12:111325489-111325511 ATCCTAGGTCTGCCACTCACTGG - Intronic
1102425711 12:112842933-112842955 ATCCTGGGTCTGACACTTCTTGG - Intronic
1102742199 12:115217768-115217790 ATTCTGGCTCTGTCACTCATAGG - Intergenic
1102759878 12:115375915-115375937 ATTCTGGCTTTGCCACTTACTGG - Intergenic
1102823246 12:115925879-115925901 ATCTTGGTTCTGCCACTTCTTGG - Intergenic
1102894297 12:116586295-116586317 ATCTTGGCTCTGCCACTTACTGG + Intergenic
1103192948 12:119017899-119017921 ATCCTGACTCTGCCACATATGGG + Intronic
1103236121 12:119374146-119374168 ATCCCAGCTCTGCCACTTAATGG + Intronic
1103428994 12:120865403-120865425 ATCCTGGGTCTACCACTTACTGG + Intronic
1103472230 12:121191152-121191174 ATCCTGGCTTGGTCACTTATTGG + Intergenic
1103715373 12:122942135-122942157 ATCCTGGCTCTGCCACTTCTAGG - Intronic
1103975460 12:124699896-124699918 ATCCTGGCTCTCCCGCTCATTGG - Intergenic
1104057588 12:125242484-125242506 GGCCAGGTTCTGCCACTGATAGG - Intronic
1104072836 12:125361325-125361347 GTCCTGGTTCTGTCACTTTCTGG - Intronic
1104128811 12:125873106-125873128 TTCCAGGCTCTGCCACTTACAGG + Intergenic
1104659112 12:130596442-130596464 ATCCTGGTTTTGCAATTGATGGG - Intronic
1105982952 13:25537351-25537373 ATCCTGGTTCTAACACTCAGTGG + Intronic
1106050802 13:26187639-26187661 ATCCTGACTTTGCCACTGATTGG - Intronic
1106150522 13:27096658-27096680 ATCCTGGCTCTGCCATTTCTTGG - Intronic
1106234744 13:27852370-27852392 ATCCTGGCTCTGCCACGTCCTGG - Intergenic
1106272043 13:28164329-28164351 GTCTTGGTTCTGCCATTTACTGG - Intronic
1106296217 13:28416224-28416246 GTCCTGGCTCTGCCACCTACTGG - Intronic
1106320021 13:28628767-28628789 ACCCTGGTTCAGCCACTCATGGG - Intergenic
1107652482 13:42559332-42559354 TTCCAGGATCTGCCACTTACTGG - Intergenic
1107978308 13:45711479-45711501 ATCCTGATTTTGTCACTGATGGG - Intronic
1108094894 13:46891305-46891327 ATCCTTGTTGTGCTACTTACTGG + Intronic
1108246815 13:48524490-48524512 ATACTGGCTCTGACACTGATTGG - Intronic
1109205889 13:59482319-59482341 AGCCTGGTTCTCCCATTTACTGG + Intergenic
1109316526 13:60755940-60755962 ATTCTGGTTCTGCAACTTACAGG - Intergenic
1110098505 13:71564295-71564317 GTCCTGCTTCAGCCCCTTATTGG - Intronic
1112481294 13:99777900-99777922 ATCTTGGTTCTGCTATTTAATGG - Intronic
1112495263 13:99899014-99899036 ATGCTGGCTCTACCACTAATGGG + Intergenic
1112670214 13:101626971-101626993 ATCCTGATTCAGACACTTATAGG + Intronic
1113284160 13:108828380-108828402 ATCCTGGCTCTGCCATTTACTGG + Intronic
1113287980 13:108874578-108874600 ATGCTAGCTCTGCCACTCATGGG - Intronic
1113461998 13:110488635-110488657 ATCCCGGTTCTGCCACTTGCTGG + Intronic
1113612752 13:111659304-111659326 AGCATGTTTCTGCCAGTTATTGG - Intronic
1115302292 14:31897979-31898001 ATCCTGGCTCTGTCACTTGCTGG - Intergenic
1115429207 14:33297173-33297195 ATCCTAGCTCTGCCATTTACTGG + Intronic
1115451805 14:33556690-33556712 ATCCTGGCTCTGCCACTGACTGG + Intronic
1115630853 14:35243681-35243703 AACCTAGTTCTGCTACTTACTGG + Intronic
1115650088 14:35396914-35396936 AGCCTGGCTCTGCCATTTACTGG + Intergenic
1115882887 14:37939874-37939896 ACCCTGGCTCTGCCACTCACTGG + Intronic
1116466820 14:45243176-45243198 ATTCTGGTGCTGCCACAAATTGG + Intronic
1117062252 14:51974918-51974940 ATCCTTGGTCTGCCACTTCATGG - Intronic
1117601998 14:57385728-57385750 ATCCTGGCTCTGCCAATTACTGG - Intergenic
1118334471 14:64841240-64841262 ATCCTGGCTCTGTCATTTACAGG - Intronic
1118372108 14:65146085-65146107 ATCCTGCCTCTGCCACTTATTGG - Intergenic
1118416444 14:65541967-65541989 ATTCTGGTTCTGCTACTTACTGG + Intronic
1118611311 14:67542438-67542460 AACTTGGCTCTGCCACTTACTGG + Intronic
1118887217 14:69877699-69877721 ATCCTGAGTCTGCCACCTAGTGG - Intronic
1119702358 14:76763641-76763663 ATCTCAGTTCTGCCACTTACTGG - Intronic
1119851566 14:77870245-77870267 ATCCTGGTTCTGCTTCTTACTGG - Intronic
1120067329 14:80058298-80058320 ATCCTGGTTTTGCTGCTTACTGG - Intergenic
1120649082 14:87109521-87109543 TTCTTGGTTCTCCCACTGATGGG + Intergenic
1120815548 14:88853604-88853626 ATTCTTGTTCTGCCACTTACTGG - Intronic
1120951927 14:90049590-90049612 ATCCTGGGGCTGCCCCTGATGGG + Intergenic
1121102435 14:91259176-91259198 ATCCTGGCTCCTCCACTTACTGG + Intergenic
1121258311 14:92548309-92548331 ATCCCAGTTCTGCCACTTATTGG + Intronic
1121584784 14:95055770-95055792 ATCCTGGCTCTGCTCCTTACAGG + Intergenic
1121592914 14:95132979-95133001 ATCGTGGTTCTGCCAGTTCATGG + Intronic
1121829265 14:97035497-97035519 ATCCTGGCTCTGCCATTTACCGG - Intergenic
1122142062 14:99668465-99668487 ATCCTGGGTCTGCCCCTTGCCGG - Intronic
1122254964 14:100469826-100469848 ATCCTGGCTCTGTCACTTGCTGG - Intronic
1122263339 14:100535371-100535393 GCCCTGGCTCTGCCACTTCTAGG - Intergenic
1122392911 14:101402542-101402564 GTCCTGGCTCTGCCGCTTAATGG + Intergenic
1122907775 14:104810107-104810129 ATCCTGGCTCTGCCAGTTCTGGG + Intergenic
1124068580 15:26369905-26369927 ATTCTGGTTCTTTCTCTTATGGG + Intergenic
1124452817 15:29812111-29812133 ATCCTGAGTCTGCCACTAAATGG - Intronic
1124901548 15:33827781-33827803 ATCCTGGTTCTGCCACTTACTGG + Intronic
1125098826 15:35886293-35886315 ATCTTGGTTCTGCTACTGACTGG + Intergenic
1125117839 15:36116398-36116420 ATGCTGATTCTGCCACATACTGG + Intergenic
1125421076 15:39504640-39504662 ATCCTGATTCTACCACTCAGTGG + Intergenic
1125704979 15:41726210-41726232 ATTCTGGTTCTGCCTCTTACTGG + Intronic
1125749492 15:42019095-42019117 GTCCTGGCTCTGCCACTCCTGGG - Intronic
1125753093 15:42043711-42043733 ATCTTGGCTCTGGCACTTACTGG + Intronic
1126669033 15:51099540-51099562 ATCCTGGTGCTGCTATTTAAAGG - Intronic
1126878991 15:53074283-53074305 ATTCTGGTTTTGCCCCTTACTGG + Intergenic
1127334710 15:57972199-57972221 GTCCTGGCTCTGCCACTCAGTGG - Intronic
1127389720 15:58495668-58495690 ATCCTGGCTCTGCCTCATGTGGG - Intronic
1127696795 15:61457692-61457714 ATTCTGATTCTGCCACTTACTGG - Intergenic
1127807541 15:62534931-62534953 ATCCTGGCTCTGCCCCTAAGTGG + Intronic
1127973815 15:63982742-63982764 GTCCTGGTCCTGCCACTTCCTGG + Intronic
1128062040 15:64741333-64741355 GTCCTGGTTCTGTCACTGATTGG + Intronic
1128366043 15:67003942-67003964 ATCCCAGTTCTGCCGCTTATTGG + Intergenic
1128566126 15:68701256-68701278 ATCCTGGCTCTGCCACTTCCAGG + Intronic
1128569074 15:68720201-68720223 ATCCTGGCTCTGCCATTTCCTGG + Intronic
1128581843 15:68816325-68816347 ATCCTGGTTCTGCCACTCACTGG + Intronic
1128600294 15:68990185-68990207 ATCCTGGCTCTGCCCCTTACTGG + Intronic
1128616849 15:69117013-69117035 ATCCTGGTTCTGCCCATTATTGG + Intergenic
1128648723 15:69395354-69395376 ATCCTAGCTCTGCTTCTTATTGG + Intronic
1128692106 15:69732559-69732581 ATCCTGGTGCTGTTACTAATGGG + Intergenic
1129484867 15:75860997-75861019 ATCTTTGTTCTGCTACTTACTGG + Intronic
1129645555 15:77427927-77427949 ATCCTGTCTCTACCACTTACTGG - Intronic
1129734769 15:77953263-77953285 TTCCTGGCTCTGCCAATGATAGG + Intergenic
1129748222 15:78039849-78039871 ATCCCAGTCCTGCTACTTATTGG - Intronic
1129794484 15:78365806-78365828 CTCCTGGCTCTGCCACTGACCGG + Intergenic
1129840821 15:78742728-78742750 TTCCTGGCTCTGCCAATGATAGG - Intergenic
1129855972 15:78825450-78825472 GTCCTGGCTCTGCCAGTTACTGG - Intronic
1130390345 15:83448683-83448705 ATCCTGCTTCTCCCACAAATTGG + Intronic
1130655115 15:85786983-85787005 GTGCTGGTTCTGCCTCTTATTGG - Intronic
1130657774 15:85804181-85804203 ATCCTGGCTCTGCCACCTTGTGG + Intergenic
1130823794 15:87522771-87522793 ATCCTGGCTCTGGCACTTTGTGG - Intergenic
1131537112 15:93246605-93246627 ATCCTGGTTCTGCCACTCTGGGG - Intergenic
1131687787 15:94789128-94789150 ATCATGGTTCTGCTAATTCTTGG + Intergenic
1131836103 15:96392683-96392705 GTCCTGGCTCTGCCTCTCATCGG - Intergenic
1131955816 15:97734973-97734995 ATCTTGGTTCTGCCATTTACAGG - Intergenic
1131990315 15:98086764-98086786 ATCCTGGCTTTGCTACTTACGGG - Intergenic
1132355298 15:101167343-101167365 ATTTTGGATCTGCCATTTATTGG + Intergenic
1132997668 16:2831627-2831649 ACCCTGATTCTACCACTTTTGGG - Intronic
1133152224 16:3843194-3843216 AGCCTGGTTCTGCCACTCACTGG + Intronic
1133266184 16:4585608-4585630 ATCCTGATTCTGCCACCTGCTGG + Intronic
1133466152 16:6028918-6028940 ATCCAGATTCTGCCACTTCCTGG + Intronic
1133699094 16:8292433-8292455 ATTCTGGCTCTGCCACTTATTGG + Intergenic
1133709391 16:8386596-8386618 ATCCTGGTTCTGTCCCTTATTGG + Intergenic
1133711205 16:8402916-8402938 TTCCTCGCTCTGCCACTTACTGG + Intergenic
1134018402 16:10905328-10905350 ATCCCGGTTCTACCACTTGCTGG - Intronic
1134080142 16:11319359-11319381 ATTCTTGCTCTGCCACTTAATGG + Intronic
1134176379 16:12010008-12010030 ATCCTGGGTTTGCCAGTTCTGGG + Intronic
1134305088 16:13024637-13024659 ATCTTATTTTTGCCACTTATGGG + Intronic
1134327279 16:13218543-13218565 TTTCTTGCTCTGCCACTTATTGG + Intronic
1134740239 16:16536528-16536550 ATTCTGGTTCTGCCACATACTGG + Intergenic
1134811496 16:17170879-17170901 GTCCTAGTTCTACTACTTATTGG + Intronic
1134927262 16:18175633-18175655 ATTCTGGTTCTGCCACATACTGG - Intergenic
1135051024 16:19193093-19193115 AACTTGGCTCTGCCACTTAGGGG + Intronic
1135210362 16:20520859-20520881 ATTCCAGTTCTGCCACTTACTGG + Intergenic
1135351984 16:21737010-21737032 CTCCTGAGTCTGCCACTTACTGG + Intronic
1135450474 16:22553133-22553155 CTCCTGAGTCTGCCACTTACTGG + Intergenic
1135484402 16:22851427-22851449 ATTCTAGTTTTGCCAATTATTGG - Intronic
1135792253 16:25407840-25407862 GTACTGGTTCTGCCACTTACAGG + Intergenic
1135796170 16:25444952-25444974 ATCCTGGCTCTGCCACTTACTGG - Intergenic
1135880687 16:26252906-26252928 ATCCTGGCTCTCCCACGTACTGG - Intergenic
1136010379 16:27359628-27359650 ATCCTGACTCTGCCACTCACTGG + Intronic
1136018761 16:27426192-27426214 ATCCCAGCTCTGCCACTTATAGG - Intronic
1136090434 16:27915881-27915903 ATTCTGGTTCTGCCACTTACCGG + Intronic
1136098660 16:27977200-27977222 ATCCTGATTCTGCCACATAGTGG - Intronic
1136144374 16:28307344-28307366 ATCTTGGCTCTGCCGCCTATTGG - Intronic
1137559962 16:49496172-49496194 ATCTTGGCTCTGCCACTTACTGG + Intronic
1138122763 16:54413779-54413801 ATCCTGGTGCTGCCTCTTTCTGG - Intergenic
1138166304 16:54804843-54804865 ATCCCAGCTCTGCCACTTGTTGG + Intergenic
1138190234 16:55008757-55008779 ATCCCAACTCTGCCACTTATGGG - Intergenic
1138276529 16:55738838-55738860 AGCCTGGCTCTGCTACTTACTGG - Intergenic
1138282454 16:55782196-55782218 AGCCTGGCTCTGCTACTTACTGG - Intergenic
1138286494 16:55814447-55814469 AGCCTGGCTCTGCTACTTACTGG + Intronic
1138510659 16:57506971-57506993 ATCCTGATCCTGCCACTTCCTGG + Intergenic
1138573305 16:57889961-57889983 ATTCTGCTTCTGCCACTTCCTGG - Intronic
1138807580 16:60108554-60108576 ATCCTGGTCCAGCCCCTTACTGG + Intergenic
1139220753 16:65179085-65179107 ATCTTGGCTCTGCCACTAACAGG + Intergenic
1140117700 16:72057105-72057127 ATCCTGACTCTGCCTCTTACAGG - Intronic
1140117917 16:72058829-72058851 ATCCTGACTCTGCCTCTTACAGG - Intronic
1140119934 16:72074858-72074880 ATCCTGACTCTGCCTCTTACAGG - Intronic
1140545885 16:75808542-75808564 ATCCTAGCTTTGCCAATTATTGG + Intergenic
1140973625 16:80038014-80038036 ATCCTGGCTCTGTCACTTAGTGG - Intergenic
1141152884 16:81576598-81576620 GTCCTGGCTCTGCCTCTCATTGG - Intronic
1141666310 16:85467240-85467262 ATCCTGCTGCTGCCTCTTACGGG + Intergenic
1142766767 17:2068777-2068799 ATCCTGGTGGTGCCCCTCATCGG - Exonic
1142915188 17:3130864-3130886 ATCCAGGCTCTGCCACTTGCTGG - Intergenic
1143020978 17:3917086-3917108 TCCCTGGCTCTGCCACTTCTTGG + Intergenic
1143096190 17:4479752-4479774 GCCCTGGTCCTGCCACTTATGGG + Intronic
1143500545 17:7336341-7336363 ATCCTGGCTCTGTCACTTAGAGG - Intergenic
1143701514 17:8664114-8664136 ATCCTAGTTCTCCCACTTCCTGG - Intergenic
1143798932 17:9361755-9361777 ATCCAGCTCCTGCCAGTTATTGG - Intronic
1144085302 17:11802937-11802959 ATCCTTGTTCTGCCACAAATTGG + Intronic
1144249303 17:13399630-13399652 AATCTGGGTCTGCCACTTACTGG - Intergenic
1144959211 17:19035474-19035496 ATGCTAGTTCTGCCACTTCCTGG - Intronic
1144975948 17:19139050-19139072 ATGCTAGTTCTGCCACTTCCTGG + Intronic
1145084397 17:19924204-19924226 ATCTTGGCTCTGCCATTTATTGG - Intronic
1146083575 17:29805995-29806017 TTTCTGGTTTTGCCACTTACTGG - Intronic
1146131136 17:30276339-30276361 ATCCTAATTCTGCCATTTACTGG - Intronic
1146270198 17:31480095-31480117 GGCCTGGATCTGCCACATATTGG - Intronic
1146373981 17:32281943-32281965 ATCCTGGCTCTGCCGCTTGCCGG + Intronic
1146570434 17:33948052-33948074 ATCCTGATTCTGCCACTTACAGG - Intronic
1146583254 17:34058952-34058974 ATCTTGGTTCTGCCATTTGCTGG - Intronic
1146944018 17:36862164-36862186 ATCCTGGCTCTGCCATTTACTGG + Intergenic
1147127442 17:38381590-38381612 ATCCTGGTTCTGCAACTCACTGG - Intronic
1147246515 17:39124667-39124689 GTCCTGGTTTTGCCACTTACTGG + Intronic
1147647304 17:42041313-42041335 ATCCTGGCTTTGCCACTTACTGG + Intronic
1147936390 17:44013700-44013722 GTCTGGGTTCTGCCACTTACTGG - Intronic
1148235914 17:45968997-45969019 ATCCTGGCTCCACCACCTATTGG - Intronic
1148354562 17:46967246-46967268 ATCCCAGCTCTGCCACTTATTGG + Intronic
1149003619 17:51781962-51781984 ATCCCAGTCCTGCCACTTACTGG - Intronic
1149089403 17:52760539-52760561 ATCTTGACTCTGCTACTTATTGG + Intergenic
1149111703 17:53040261-53040283 TTCCTGATTTTGTCACTTATGGG - Intergenic
1149502665 17:57166319-57166341 ATCCTGCTTCTGCAATTTACTGG - Intergenic
1149538895 17:57453882-57453904 ATCCTGGCTCTGCCAATTCCTGG - Intronic
1150186992 17:63192618-63192640 ATCCTGGCTCTGCCATTTACTGG + Intronic
1151951177 17:77354961-77354983 ATCCTGGCTCAGCCAATTATTGG - Intronic
1153095243 18:1393781-1393803 GTCCTGGTTCTTCTACTTACTGG - Intergenic
1153373248 18:4344718-4344740 ATCCTGACTCTGCCACCTTTTGG - Intronic
1153589934 18:6662955-6662977 ATTGTGGATCTGCCACTTACTGG + Intergenic
1153910014 18:9698453-9698475 TTTCTGGTTCTGCCACTTCGTGG + Intergenic
1155000536 18:21681771-21681793 ATCCTGGCTCTGTCATTTGTTGG + Intronic
1155203905 18:23540724-23540746 ATCCTGACTCTGCCACTTACGGG + Intronic
1155528336 18:26740369-26740391 TTCCTGGTTCTACCACTTACTGG + Intergenic
1155658387 18:28218660-28218682 ACCCTGGTTCCCACACTTATTGG - Intergenic
1155867999 18:30990654-30990676 GTCTTGATTCTGCCACTTACAGG - Exonic
1156363837 18:36407766-36407788 ATCCTGGTTCTGTCAGTCAGTGG + Intronic
1156679946 18:39576321-39576343 ATCCTGATTCTGTCCCTTATTGG - Intergenic
1157931788 18:51831801-51831823 ATCCTGGATCTGTCATTTACTGG - Intergenic
1158140221 18:54247352-54247374 AACCTGATTCTTCCACTTAGTGG - Intergenic
1158147567 18:54333026-54333048 GTCCTGGTTCTATCACATATTGG + Intronic
1158514576 18:58120317-58120339 GTCCTGGTTCTGCTATTCATTGG + Intronic
1158535377 18:58303822-58303844 ATCCTAGTCCTGCCACTTTCTGG + Intronic
1158655504 18:59327369-59327391 ATCCTGGCTCTCTCACTTACTGG - Intergenic
1158877814 18:61749899-61749921 ATCCTGGCTATTGCACTTATTGG - Intergenic
1158944105 18:62433482-62433504 ATTCTGGCTCTGTCACTTACTGG - Intergenic
1158987201 18:62830202-62830224 ATGCATGTTCTGCCACTAATTGG + Exonic
1159001111 18:62975942-62975964 ATCTTAGCTCTGCCACTTGTAGG + Intronic
1159038843 18:63303727-63303749 ATCCAGGGTCTGGCACATATTGG + Intronic
1159634741 18:70790687-70790709 ATCATGGCTTTGCCACTTATTGG - Intergenic
1160319956 18:77881025-77881047 ATCCTGGTTTGGACACTGATCGG + Intergenic
1160482242 18:79252318-79252340 ATGCTGGCCCTGCCACTTAGCGG - Intronic
1161520653 19:4721928-4721950 ATCCTGACTCTGCCACTTCTGGG + Intronic
1162316065 19:9938739-9938761 ACCCTGGTGCTGCCACTTCTTGG + Intergenic
1162365400 19:10245671-10245693 ATCCAGGCACTGCCACTAATTGG - Intergenic
1162922312 19:13910462-13910484 ATCCGAGCTCTGCCACTTACTGG + Intronic
1163349995 19:16770560-16770582 ATCTTGGCGCTGCCACTTCTTGG + Intronic
1163499196 19:17665559-17665581 ATCCTGGCTCTGCCAGTTGCCGG + Intronic
1163805705 19:19395840-19395862 ATCCTGATTCTACCACTTGCTGG + Intronic
1164132268 19:22374980-22375002 ATCCCAGTTCGGCCACTTAACGG - Intergenic
1164217727 19:23164290-23164312 ATCTCAGTTCTCCCACTTATGGG + Intergenic
1164525577 19:29010906-29010928 CTGCTGGTTCTGCCACTGAAGGG - Intergenic
1164597104 19:29537503-29537525 ATCCTGTTTCTGGAAGTTATTGG + Intronic
1164867110 19:31613848-31613870 ATCCTACTTCTGCCATTTATTGG - Intergenic
1165411536 19:35665437-35665459 ATCCCGGTTCTGCCTCTTCTGGG - Intergenic
1165744919 19:38224809-38224831 ATCCTAGCTCTGCCACTTGGTGG + Intronic
1165765310 19:38346783-38346805 ACCCTGGTTCTGCCACCTCCTGG + Intronic
1165909037 19:39212587-39212609 ATCCTGCCTCTGCCTTTTATGGG + Intergenic
1165977929 19:39693647-39693669 CTCCTGATTCTGCCTCTTACTGG - Intergenic
1166625281 19:44346214-44346236 ATCCTGACTCTACCACTTACTGG + Intronic
1166726716 19:45032878-45032900 ATCCTGGCTCTGCTGCTTACTGG + Intronic
1166818215 19:45559904-45559926 ATCCTGGTTCTGTCACTTTCTGG + Intronic
1166864863 19:45829680-45829702 GTCCTGATTCTGCCACTTGCTGG - Intronic
1167289907 19:48618877-48618899 ATCCTGGCTCTGCCACTTCCTGG + Intronic
1167559023 19:50214401-50214423 ACCCAGTTTCTGCCACTAATAGG + Intronic
1167564623 19:50248655-50248677 ATCCCAGCTCTGCCACTTAGGGG - Intronic
1167565765 19:50255679-50255701 ATCCCAGCTCTGCCACTTACTGG - Intronic
1167974781 19:53216481-53216503 ATCCTGATTCACCCACTTACAGG - Intergenic
925655485 2:6143286-6143308 ATCCAGTTTCTGCCACTGAAGGG - Intergenic
925732432 2:6928885-6928907 ATCCTCTTCCTGCCACTTCTGGG + Intronic
926263662 2:11293192-11293214 ATCACGGTTCTGCCATTTAGTGG + Intronic
926691566 2:15738116-15738138 ATCCCAGCTCTGCCACTTACTGG + Intronic
926743725 2:16133581-16133603 ATCTTGGTTCCGACACTTACCGG + Intergenic
926802276 2:16669040-16669062 ATCCTAATTCTGCCACTCACTGG + Intergenic
927123167 2:19988114-19988136 ATCCTTGTTCCGCCACTTACTGG + Intronic
927219363 2:20693041-20693063 ATCTTGGTTCTGCCATTTATTGG + Intronic
927493736 2:23538132-23538154 ATCCTAGTTCTGCTACTTATTGG - Intronic
927959450 2:27231819-27231841 ATCCTGGGTCTACCTCTCATTGG - Intronic
928439535 2:31280452-31280474 ATCCTAGATCTGCCATTTATTGG - Intergenic
928497926 2:31853481-31853503 ATACTGGTTCAGCCACTTATCGG + Intergenic
928611249 2:32994395-32994417 ATCTTGGTTCTACCACTTACTGG - Intronic
929089398 2:38199932-38199954 TTCCTCTTTCTGCCCCTTATAGG + Intergenic
930011760 2:46942700-46942722 ATCCTGGTTCCACAACTTATTGG - Intronic
930084818 2:47488757-47488779 ATCCCAGCTCTGCCACTTACTGG - Intronic
930368675 2:50476365-50476387 ACCCTGGCTCTGCCACCTACTGG + Intronic
930784036 2:55253074-55253096 ATCCTGGCTATGCTACTTACTGG + Intronic
931448043 2:62343431-62343453 AGGCTGTTTCTGCCATTTATTGG + Intergenic
931759612 2:65405195-65405217 GTCCTGATTCTGCCACTTGTTGG - Intronic
932060035 2:68487397-68487419 ATCCTGGCCCTACTACTTATTGG + Intronic
932124780 2:69133902-69133924 ATCATGGTTCTGCTGCTTACAGG + Intronic
932411848 2:71552270-71552292 ATCCTGGCTCTAGCACTTACCGG + Intronic
932735032 2:74248426-74248448 CTCCTTGTTCTGCCTCTTCTCGG - Exonic
933248841 2:80005534-80005556 ATCTTGGTTTTGGCACTTAATGG + Intronic
934952811 2:98590391-98590413 ATCCTGGTTCTGCCCCTGACTGG + Exonic
935060432 2:99602334-99602356 ATCCCGGTGCTGTGACTTATAGG + Intronic
935282621 2:101532311-101532333 ATCCTGGTTCTGCCATTTACAGG - Intergenic
935495804 2:103780242-103780264 ATCCTAATTCTGTCACTTACTGG - Intergenic
936066128 2:109333726-109333748 ATCCCAGCTCTGCCACGTATTGG + Intronic
936071207 2:109372634-109372656 ACCTTGGTTCTGCCACTCCTCGG - Intronic
937029310 2:118724843-118724865 ATCCTGATTCTGCCATGTACTGG + Intergenic
937359829 2:121221131-121221153 GTCCTGGTCCTTCCACTAATGGG + Exonic
937591865 2:123623440-123623462 GTTCAGATTCTGCCACTTATTGG - Intergenic
938577263 2:132616278-132616300 ATCCTGGCTCTGCCTCTCACTGG - Intronic
938668614 2:133565507-133565529 GTCCTGCTTCTGCCACTTGCCGG - Intronic
939558672 2:143708084-143708106 GTCTTGGCTCTGCCACTTACTGG + Intronic
939569371 2:143822349-143822371 TGCCTTGTTCTGCCATTTATAGG - Intergenic
940187891 2:151007024-151007046 ATCTTGGCTTTGCCACTTATCGG + Intronic
940932233 2:159446447-159446469 ATCCTGGCTCAGTCACTTAGTGG + Intronic
941262182 2:163311274-163311296 ATCCTAGTTCTACCACTCGTTGG - Intergenic
941346432 2:164374490-164374512 ATCCTGCTTCTGCCAACTACTGG - Intergenic
941972055 2:171361689-171361711 ATTCTGGTTCTGCCACTTCCTGG - Intronic
942297991 2:174535772-174535794 ATCCCTGTTCTGCCACTTAATGG - Intergenic
942514343 2:176736484-176736506 ATCTTGGTTCCACCACTTAACGG - Intergenic
942611654 2:177747921-177747943 ATCCTGGCTCTGCCACCAACAGG - Intronic
942718385 2:178921021-178921043 GTCCTGGTACTGCCTCTTACTGG - Intronic
943634988 2:190296496-190296518 ATACTGGTTCTGCCTCTGAGAGG - Intronic
944354332 2:198767867-198767889 ATCCTGGCTCTGCCACTTCCTGG - Intergenic
944529529 2:200653550-200653572 ATCCTTGTTCTGCCATTTATTGG - Intronic
945653016 2:212588412-212588434 ATCCTGGTTCTGGTACCTACTGG + Intergenic
945961940 2:216144686-216144708 ATCCTGGTACAGACACTCATTGG + Intronic
946147619 2:217742924-217742946 ATCCTGGCTCTGCCTCTTGCTGG - Intronic
946389440 2:219406618-219406640 ATCCTGGATCTCCCACTCTTGGG - Intergenic
946521882 2:220474745-220474767 ATCCCAGTTCTGCCACTAATCGG - Intergenic
946649844 2:221880317-221880339 ATCCTGGCTCTGCTACTCACTGG + Intergenic
947029876 2:225782235-225782257 AGTCTGCTTCTGCCACTCATGGG - Intergenic
947459977 2:230295597-230295619 ATCCTGGATCTGCCACTTAAGGG - Intronic
947470213 2:230394733-230394755 ATCCTGGATCTGCCACTCGGGGG - Intronic
948017547 2:234702552-234702574 ATCCTGATTTGGCCACTTTTGGG - Intergenic
948829289 2:240590165-240590187 GTCCTGGCTCTGCCACTTTACGG - Intronic
1168867843 20:1104502-1104524 ATCCTTGCTCTACCACTTGTTGG - Intergenic
1168876947 20:1178330-1178352 ATCCAGGCTCTGCCACTTACTGG - Intronic
1169870614 20:10244528-10244550 ATCTTGGCTCTGCCACTCACTGG - Intronic
1170140668 20:13122536-13122558 ATCCTTGTTCTACCACCTTTTGG + Intronic
1170404485 20:16021762-16021784 ATTCTGATTCTCCGACTTATTGG - Intronic
1170800698 20:19587691-19587713 ATCCTGATTCTGCCATTTTCTGG + Intronic
1170923447 20:20701144-20701166 ATGCTGATTCTGCCACTCATTGG + Intronic
1172040632 20:32042297-32042319 ATCCCAGCTCTGGCACTTATTGG + Intergenic
1172588832 20:36103461-36103483 ATCTTGATTCTGCCATTTCTGGG + Intronic
1172888968 20:38250241-38250263 ACTCTGGTTCTGTCACTTACTGG + Intronic
1173011956 20:39191001-39191023 ATCCCAGCTCTGCCACTTACAGG - Intergenic
1173658491 20:44717139-44717161 ATCCTGATTCTGTCTCTTACTGG + Intronic
1173671188 20:44800056-44800078 ATCTTGGCTCTGCCGCTTATTGG - Intronic
1173761356 20:45563427-45563449 ATCCTGAATCCACCACTTATCGG + Intronic
1173772007 20:45668054-45668076 ATCTTGTTTCTACCACTTATTGG - Intronic
1173833106 20:46105389-46105411 ATCCTGGCTCTACCATTTACTGG + Intergenic
1173849663 20:46210053-46210075 CTCCTGGTTCTCTCCCTTATTGG + Intronic
1173894494 20:46540427-46540449 ATCCTGGCTCTGCGGCTTATTGG + Intergenic
1173968035 20:47128678-47128700 ATCCCAGCTCTGCCACTTATTGG + Intronic
1174201389 20:48808904-48808926 ATCCAGGCTCTGCCCCTTCTAGG - Intronic
1174306297 20:49616440-49616462 ACCCTGGCTCTGCCACTTCCTGG - Intergenic
1174457030 20:50656267-50656289 ATCCTAGCTCTGCCACTTGCTGG + Intronic
1174533059 20:51230006-51230028 ATCCTGGTTCTTTCACCTTTGGG - Intergenic
1174565925 20:51464416-51464438 ATCCTGCCTCTGCCACTTACTGG - Intronic
1174570309 20:51496714-51496736 ATCCTGGTTCTGCCACTTATTGG - Intronic
1174604434 20:51750700-51750722 ATCCTGGCTCTGTCCCTTATGGG - Intronic
1175500582 20:59447503-59447525 ATCCCAGTGCTGCCACTTATTGG + Intergenic
1177046445 21:16175956-16175978 ATCTTGGTTTTGCCACTGATTGG + Intergenic
1177185758 21:17794207-17794229 ATCCTTGATCTGCTACTGATTGG + Intronic
1177227315 21:18274283-18274305 ATCCTGGCTTTAACACTTATTGG - Intronic
1178464934 21:32839394-32839416 ATCCTGGCTCTGCCACTAAATGG - Intergenic
1178711038 21:34916973-34916995 GTCCTGGCTCTGCCACTTGCTGG - Intronic
1178717847 21:34982930-34982952 ATCTTGGTTCTACCACCTAACGG - Intronic
1179039033 21:37785253-37785275 TTCCTGGTCCTCCCACTTCTTGG - Intronic
1179256797 21:39723718-39723740 ATCCTGATTCTGGCCCTAATTGG - Intergenic
1179307550 21:40168836-40168858 ATTCTGGTTCTATCACTTGTTGG + Intronic
1181623752 22:24108211-24108233 ATCCCAGATCTGCCACTTAGGGG - Intronic
1181962465 22:26632625-26632647 CTCCTGGTTCTGCATTTTATAGG + Intergenic
1182030522 22:27155866-27155888 ATGCTGGTTCTGTCACTTCCTGG - Intergenic
1182067506 22:27441225-27441247 ATCCTTGTTCTGCCTCCTACAGG + Intergenic
1182087699 22:27572981-27573003 ATCCTGCTTCTGCCAATTTCAGG - Intergenic
1182219120 22:28743799-28743821 AGCCTGGTTCTTGCTCTTATGGG - Intronic
1182461207 22:30485366-30485388 ATCCTGGGTCTGTCACTTGCAGG - Intergenic
1182578337 22:31289023-31289045 ATCCAGGTTCTGCCACTCCTAGG + Intronic
1182787808 22:32922269-32922291 ATCCTAGCTTTGCCACTTATTGG + Intronic
1182806944 22:33080601-33080623 ATTCTGATTCTTCCACTTCTAGG - Intergenic
1182865193 22:33598208-33598230 ATCCTGGCTCTGCCATGTACCGG + Intronic
1182937821 22:34242705-34242727 ATCCCAGTTCTGCCAATTGTGGG - Intergenic
1183006525 22:34907404-34907426 GTCCTGGCTGTGCCACTTTTTGG - Intergenic
1183014646 22:34975910-34975932 ATCCTGGCTCTGCCACCTACTGG + Intergenic
1183038130 22:35155662-35155684 ATCCTGGTTGTGCCATTACTGGG + Intergenic
1183083233 22:35470529-35470551 ATCCTGTTTCTGCCACTTCCTGG + Intergenic
1183319329 22:37155587-37155609 ATCCTGGCTCTGCCACATTCTGG - Intronic
1183625957 22:39001891-39001913 ATCCTGCTTCTGCCACTTACTGG + Intergenic
1183737674 22:39652943-39652965 ATCCTGGTTCTGCTATTGACTGG + Intronic
1184115234 22:42418181-42418203 CTCCTGGCTCTGCCACTTCAAGG + Intronic
1184177786 22:42799400-42799422 ATCCTGGCACTGTCACTTCTAGG + Intronic
1184349891 22:43936593-43936615 ATCCTGGCTCTGCTATGTATTGG + Intronic
1184403740 22:44288231-44288253 ATTCTGCTTCTGCCCCTTAATGG - Intronic
1184615272 22:45633768-45633790 TTCCTGCTTCTGCCACATACTGG + Intergenic
1184650590 22:45917851-45917873 ATCCTGGTTCTGCCTTTCACTGG + Intergenic
950187130 3:10952111-10952133 ATCCTGGCTCTGCCACTTCCTGG + Intergenic
950217644 3:11170624-11170646 ATCCTGGCTCTGCCACTGACCGG - Intronic
950275882 3:11660221-11660243 ATCTTGGTTCTGCCACAGACTGG + Intronic
950286494 3:11749293-11749315 GTCCTGGTTCCACCACTTACTGG - Intergenic
950316642 3:12006589-12006611 ATCCTGCTTCTACCACTTGCTGG - Intronic
950521366 3:13499880-13499902 ATCCTGGTTCTGCCATTACCTGG + Intronic
950551098 3:13666320-13666342 CTCCAGGCTCTGCCACTTCTAGG + Intergenic
950657824 3:14447984-14448006 ATCCCAGTTCTGCCACTTACTGG + Intronic
951333424 3:21392593-21392615 ATCCTGATTCTGCCACTTCCAGG - Intergenic
951743701 3:25953242-25953264 ATCCAGGATCTGCCATTTACTGG + Intergenic
951993094 3:28697980-28698002 ATCCTGGTTTTGAGTCTTATTGG + Intergenic
952818410 3:37465458-37465480 ATCCCAGCTCTGCCACTTACTGG + Intronic
953624654 3:44560956-44560978 ATCCTGGTCCTCCCACTTGATGG - Intronic
953638592 3:44684866-44684888 ATGCTGGCTCTGCCACTTAGGGG + Intergenic
953725746 3:45396795-45396817 ATCCTGGCTCTGCCATGTCTTGG - Intronic
953777528 3:45833901-45833923 ATCCTGGCTCTGTCACTTCCTGG - Intronic
954702421 3:52457194-52457216 AACCTGGTTCTGCCATTTCCTGG - Intronic
954837558 3:53483069-53483091 ATCTTAGTTCTGCCATGTATTGG + Intergenic
955825562 3:62943191-62943213 ATCCCAGTTCTGCCATTTATTGG + Intergenic
955941730 3:64152462-64152484 ATCTCAGATCTGCCACTTATTGG + Intronic
956005090 3:64770161-64770183 ATCTTGGCTCTGCCACTCACTGG - Intergenic
956051810 3:65256126-65256148 TTCCTAGTTCTACCACTTACTGG + Intergenic
956425385 3:69129081-69129103 ATCCTGGTTGTGCCACTGACTGG + Intergenic
956707096 3:72008488-72008510 ATCTTGGTTTAGCCACCTATTGG + Intergenic
956893338 3:73634831-73634853 ATCCTGATTCTACTACCTATTGG + Intergenic
956923482 3:73956201-73956223 ATTCTAGTTCTGCCACTAACTGG + Intergenic
957404827 3:79764021-79764043 ATCCTGGCTCTGCCCCTTTTTGG + Intronic
957951641 3:87135314-87135336 ATCCTGATTCTGCCACTTACCGG - Intergenic
958794759 3:98695182-98695204 ATCCTGGTTCTGCCATTTTCTGG + Intergenic
958794891 3:98696407-98696429 ATCCTGGTTCTGCCATTTTCTGG - Intergenic
959445845 3:106438343-106438365 ATCCTGGCTCTCTCACTTACTGG - Intergenic
959814900 3:110663893-110663915 TGCCTGGTTCTGCCAGTTGTAGG - Intergenic
960034425 3:113088203-113088225 ATCCTGGCTCTGCCATTTATTGG - Intergenic
960571085 3:119185974-119185996 AGCCTAGCTCTGCCACTTACTGG + Intronic
960614184 3:119581868-119581890 ATCCCAGCCCTGCCACTTATTGG + Intronic
960719045 3:120607388-120607410 ATCTTTGCTCTGCCACTTACTGG + Intergenic
960815273 3:121665379-121665401 ATTCTGGCTCTGCCGCTTACTGG - Intronic
960987595 3:123290831-123290853 ACCCCAGCTCTGCCACTTATTGG + Intronic
961022957 3:123524858-123524880 ATCCTGACTCTGCCATTTATTGG + Intronic
961122170 3:124382064-124382086 ATCCTGGTTCTGCCACTTACTGG + Intronic
961237440 3:125379358-125379380 ATCCTGACTCTACCACTTACTGG + Intergenic
961455086 3:127020093-127020115 ATCCTGGCTCTGACACTTACTGG - Intronic
961569892 3:127790114-127790136 ATCCTGGATCTGCCCCTGACTGG + Intronic
961772443 3:129259946-129259968 ATCTTGGTTCTGCCACTTACTGG + Intronic
961837983 3:129680470-129680492 ATCCTGACTCTGCTGCTTATTGG - Intronic
962479976 3:135789354-135789376 GTCCTGGCTCTGCCACTTGCTGG + Intergenic
962889876 3:139662285-139662307 ATCCTGGTTCTGTCACTGATGGG + Intronic
963077562 3:141361384-141361406 TTCCTGGTCCTGCCACTTCTGGG + Intronic
963284539 3:143420434-143420456 ATCCTAGTTCTGCCTCATCTTGG + Intronic
963779254 3:149470615-149470637 ATCCTGGTCCTGCCAGCTACAGG + Intergenic
964107395 3:153054143-153054165 ATGCTGTTTCTGCCTCTTATTGG + Intergenic
964186373 3:153949635-153949657 AGCCTGGTTCTCCCGCTTACAGG + Intergenic
964222271 3:154360553-154360575 ATTCCAGTTCTACCACTTATTGG - Intronic
964380321 3:156092120-156092142 ATTCTGATTCTGCCACTTACTGG + Intronic
964444561 3:156745086-156745108 ATCCTAGTTCTGCCATTAAATGG - Intergenic
964558354 3:157965529-157965551 ATCCTGGCTCTGCTGCTTAAGGG + Intergenic
965454277 3:168878224-168878246 TTCCTGGTTTTGTCACTTATTGG + Intergenic
965658675 3:171017748-171017770 GTCCTGGTTCCCCGACTTATGGG + Intronic
965677891 3:171218180-171218202 ATCCTAGTTCTGACACTTCATGG - Intronic
965690425 3:171350839-171350861 ATCTTGGCTCTACCACTTATTGG - Intronic
965822175 3:172695494-172695516 ATTTTGACTCTGCCACTTATGGG + Intronic
966113556 3:176432933-176432955 ATCATAGCTCTGCCACTTAGGGG - Intergenic
966187111 3:177237455-177237477 ATCTTGGCTCTGCCTCTTACTGG + Intergenic
966339964 3:178914765-178914787 ATCTTGTGTCTGCCACTTACTGG - Intergenic
966440899 3:179942917-179942939 ATTCTGGCTCTGCTACTTATGGG + Intronic
966571668 3:181450964-181450986 ATCCCAACTCTGCCACTTATTGG + Intergenic
966598929 3:181755565-181755587 ATTCTAGTTCTTCCACTTGTTGG - Intergenic
966780156 3:183577420-183577442 ATCCCTGCTCTGCCACTTACTGG - Intergenic
966784783 3:183613395-183613417 ATCCCAGTTCTGCTACTTACTGG - Intergenic
966851155 3:184165862-184165884 TTCCTGGCTCTGCCACTTACTGG + Intronic
969097463 4:4744406-4744428 GTCCTGCCTCTACCACTTATGGG + Intergenic
969241462 4:5901429-5901451 ATCTGGGTTCTGCAAGTTATTGG - Intronic
969286914 4:6208324-6208346 ATCCTGGCTCTACCACTTTCCGG - Intergenic
969635891 4:8369398-8369420 ATCCTGGCTCTGCCACTCCCTGG + Intronic
969844217 4:9907319-9907341 ATCCTGGCTCCGGCACTTCTTGG - Intronic
970313913 4:14811119-14811141 ATCCTGGTTCTAGCCCTTTTTGG - Intergenic
970344881 4:15143795-15143817 ATTCTGGCTCTGCCACTAATAGG + Intergenic
970394369 4:15651251-15651273 TTACTAGTTCTGCTACTTATTGG - Intronic
970473093 4:16395806-16395828 ATCTGCCTTCTGCCACTTATGGG - Intergenic
970532210 4:16996327-16996349 ATCCTGGCTCTGCCACCTCCTGG + Intergenic
970554757 4:17220115-17220137 TTCCAGGTACTGCCACTGATTGG - Intergenic
970850612 4:20598374-20598396 ATCCAGCTTCTGCCATTTACAGG + Exonic
970898898 4:21135773-21135795 ACCCAGGCTCTGCCACTTACTGG + Intronic
970904943 4:21204504-21204526 ATCCAGGCTCTGCCAATGATTGG + Intronic
971140126 4:23915983-23916005 ATCCTGGCTCTGCCATTTATAGG + Intergenic
971524134 4:27594595-27594617 ATCTTGGTTCTACCACTTACTGG + Intergenic
972156923 4:36174789-36174811 ATTCTTGTTCTGCTACTAATTGG - Intronic
972306661 4:37837246-37837268 AGCCTGGCTCTGCCACTAAGTGG + Intronic
972759833 4:42092358-42092380 ATCCTGACTCTGCCTTTTATTGG - Intergenic
973699177 4:53519964-53519986 ATTCTGTCTCTGTCACTTATAGG - Intronic
974096614 4:57371174-57371196 ATCCTGGCTCCACCACTTCTTGG - Intergenic
974240623 4:59241313-59241335 ATTGTAGGTCTGCCACTTATTGG - Intergenic
974618675 4:64326033-64326055 ATCATGCTTCAGCCACTTAAGGG + Intronic
974748588 4:66106901-66106923 ATCCTGCTTCTCTCACTCATAGG + Intergenic
975358581 4:73438945-73438967 ATCCTGGCTCTGCCATTTGGTGG - Intronic
975388465 4:73787407-73787429 ATCCTGTTTCAACCATTTATAGG + Intergenic
975433403 4:74321701-74321723 ATCCAGGTTCCACCACTTACTGG - Intergenic
975681943 4:76886007-76886029 AACCAGGTCCTGCCATTTATTGG - Intergenic
976003784 4:80402664-80402686 ATCCTACTTCTGCCTTTTATTGG - Intronic
976128613 4:81859737-81859759 ATCCCAGCTCTGCCACTTATTGG - Intronic
976944839 4:90752231-90752253 ATTTTGGTTCTGCCATTTATTGG - Intronic
977145569 4:93435731-93435753 ATCCTGGTTCTTCCAGTTATTGG - Intronic
978629538 4:110728043-110728065 ATCCTGGCTCTAGCACTTACTGG + Intergenic
979411289 4:120383100-120383122 ATCCTGGTTCTGCCACTATTGGG - Intergenic
979589093 4:122457802-122457824 ATCCTTCTTCTGCCCCTTACTGG - Intergenic
980245489 4:130234554-130234576 ATCCTTGTTCTGTCATGTATAGG + Intergenic
980342390 4:131567432-131567454 ATCCAGTTTCTGTCACTTAGGGG - Intergenic
980998669 4:139807125-139807147 TTCCAGTTTCTGCCACTTGTTGG + Intronic
981041557 4:140227640-140227662 ATCCTTGTTCTGCAACTTACTGG + Intergenic
981196925 4:141932022-141932044 ATCCAGGCTCTGCCACTAACTGG - Intergenic
981943864 4:150317763-150317785 ATCCTACTTCTGCCACTGACTGG + Intronic
982841536 4:160193972-160193994 ATCCTGGTTCTGCCACTTGGTGG + Intergenic
983514507 4:168642035-168642057 ATCCTGGCTGTGCTCCTTATGGG - Intronic
984193041 4:176627077-176627099 ATCCTAGATCTGCCTCTTATTGG + Intergenic
984853621 4:184174636-184174658 ATCCTGGTTCTGACACATACTGG - Intronic
985252006 4:188033722-188033744 ATCCTGGCTCGGCCGCTTACTGG + Intergenic
986184246 5:5421947-5421969 ATCCTGTTTTTGACACTTCTCGG - Intronic
986355790 5:6924430-6924452 ATCCTGGCTGGGCCACTTGTTGG + Intergenic
986698377 5:10378398-10378420 ATCCTGGTTCTGCCACTAACTGG - Intronic
986749744 5:10776348-10776370 ATTCTGCTTCTGCCACTTGCTGG + Intergenic
987025642 5:13924096-13924118 ACCTTGGCTCTGCCACCTATTGG - Intronic
989085025 5:37666804-37666826 ATCCTGGCTCTGCCCCTTACTGG + Intronic
989187953 5:38643055-38643077 ATCCTGGTTCTGTCATTTAGGGG + Intergenic
989273385 5:39558137-39558159 ACCCTGGCTCTGCTATTTATTGG + Intergenic
990514652 5:56520094-56520116 GTCCTGGTTCTGCCACTTCCTGG + Intronic
990849708 5:60188792-60188814 ATACTGGTTCTGCCATTCCTGGG - Intronic
991024583 5:62016145-62016167 GTCTTGGCTCTGCCACTTACTGG - Intergenic
991303789 5:65154576-65154598 ATTCTGGCTCTGCCTCTTCTAGG + Intronic
991401238 5:66253963-66253985 ATCCCAGCTCTGCCACTTAGGGG - Intergenic
991411021 5:66345909-66345931 ATCCCAGCTCTGCCACTTACAGG + Intergenic
992000182 5:72428619-72428641 ATCCTGGCTCTGCCACCTGTTGG - Intergenic
992160777 5:73999061-73999083 ATTCTGGCTCTGCCACTTACTGG - Intergenic
992373315 5:76167703-76167725 ATCCAGCCTCTGACACTTATTGG - Intronic
992765408 5:79994279-79994301 ATCTTGGTTCTACCACCTACTGG - Intronic
993101212 5:83541936-83541958 CTTCTGCTTCTGCCACCTATGGG + Exonic
995248463 5:109962193-109962215 ATCCTGGCCCTGCCATTTACTGG + Intergenic
995458154 5:112373656-112373678 ACCCTGGCTCTGCCACTTGCTGG - Intronic
995625599 5:114072718-114072740 ATCCTGGATCTACCACTAACTGG + Intergenic
995786687 5:115838413-115838435 ATCCTGGCTCTGCCACTTGCTGG + Intronic
995919276 5:117291754-117291776 GTTCTGGTTCTTCCACTAATTGG - Intergenic
997647598 5:135491455-135491477 ATCCTGGCTCTGCCACTGTTTGG - Intergenic
997784569 5:136697665-136697687 GTCCTGTTTCTGACACATATAGG + Intergenic
998166880 5:139849215-139849237 ATCCCAGCTCTGCCACTTCTTGG - Intronic
998270864 5:140705404-140705426 ATTCTGTTTCTTCCACTTACTGG + Intronic
998795359 5:145812425-145812447 AATCTGGTGCTGCCACTTACTGG + Intronic
998841013 5:146253814-146253836 ATCCTAGTTGTGCTGCTTATTGG + Intronic
998998387 5:147892515-147892537 ATCCTCTTTCTGTCACTTATTGG + Intronic
999126359 5:149249128-149249150 ATCCTGGCTCAGTCACTTACTGG - Intronic
999345058 5:150810604-150810626 GTCCTGGATCTGCCACTTACTGG - Intergenic
999656386 5:153814859-153814881 ATCCTGGTGCTGTCACTTACAGG - Intergenic
999674549 5:153985994-153986016 ATCCTGGTTCTACCACTTGTTGG + Intergenic
999803353 5:155058389-155058411 ATCCTGGCTCTACCACTTACAGG + Intergenic
999837989 5:155394982-155395004 ATCCTGGCTCTACCACCTACTGG - Intergenic
999842116 5:155438969-155438991 ATCCTGGCTTTGTCACTTATGGG - Intergenic
1000106954 5:158068862-158068884 ATCCCGGCTCTGCCACTTATTGG - Intergenic
1000112260 5:158120270-158120292 ACCCTGGCTCTACCACTTATTGG - Intergenic
1000246822 5:159455062-159455084 ATCCCAGTTCTGCCATTTTTTGG + Intergenic
1000255435 5:159533948-159533970 ATGCTGACTCTACCACTTATTGG + Intergenic
1000412866 5:160951881-160951903 ACACTTGCTCTGCCACTTATAGG - Intergenic
1000668435 5:164028067-164028089 ATCCTGGCCTTGCCACTTACTGG + Intergenic
1001082864 5:168679830-168679852 ATCCTAGCTCTGCCACTTACTGG + Intronic
1001137185 5:169112342-169112364 ATCCTGGATCTGCCACCTCTTGG + Intronic
1001199870 5:169706406-169706428 GTCCTGGCTTTGCCACTTTTTGG + Intronic
1001411177 5:171513118-171513140 ATCCTGGTTCTGCCATTTTGGGG + Intergenic
1001519368 5:172379819-172379841 ATCCTGCCTCTGCCACTCCTGGG - Intronic
1001555432 5:172633812-172633834 GTCCTGGTTCTGCCACTCTCTGG - Intergenic
1001593499 5:172882530-172882552 ATCCTAGCTCTGCCACTCACTGG + Intronic
1001596825 5:172903804-172903826 ATCCTGGCTCTGCCACCTCTTGG - Intronic
1001833733 5:174811866-174811888 ATCCTCCTTCTGCCACTTATGGG + Intergenic
1002027268 5:176404119-176404141 ATCCTGGTTCTGCCACTTCCTGG - Intronic
1003378520 6:5601621-5601643 ACCTTGGCTCTGCCACTTACTGG + Intronic
1003448788 6:6211088-6211110 ATTCAGGTTCTGCCACTTATTGG + Intronic
1004115201 6:12759890-12759912 ATCCTCACTCTGCCACTTACTGG + Intronic
1004174086 6:13323862-13323884 ATCCTAGCTCTGCCACTTACAGG + Intronic
1004306352 6:14505213-14505235 AATCTGGTTCTGTCATTTATTGG - Intergenic
1004316314 6:14591212-14591234 ATCCTGCCTCTGCTACTTATTGG + Intergenic
1004612336 6:17255300-17255322 ATCCTAGCTCTGCCTCTTACTGG - Intergenic
1005399602 6:25418102-25418124 ATTCTGGCTCTGCCACTTTCTGG - Intronic
1005595318 6:27373667-27373689 ATCCTGGCTTTGAAACTTATTGG - Intergenic
1005599878 6:27415754-27415776 ATCCTGGTTCTGTCATATATTGG + Intergenic
1005695675 6:28350466-28350488 ATCCTGCCTCTGCCACTTACTGG + Intronic
1005804186 6:29458650-29458672 ATCCTGGCACTGACACTCATTGG + Intronic
1005892667 6:30153094-30153116 CTCCTGGTGTTGCCACTTCTGGG - Exonic
1005913625 6:30332157-30332179 TTCCTGGTTTTGCCACTTACTGG - Intronic
1007230778 6:40346302-40346324 ATCCTGGTTTGGCCACTCACTGG + Intergenic
1007342382 6:41199791-41199813 ACCCTGTTTCTACCACTTAGTGG + Intronic
1007769294 6:44180304-44180326 GTTCTGGTTCTGCCACTAACTGG - Intronic
1008389641 6:50935157-50935179 ATCCTAATTCTTCCACTTAATGG - Intergenic
1008455407 6:51705183-51705205 CTCCTGGTTCTTCTACTTCTCGG - Intronic
1010046292 6:71447766-71447788 ATTCTGGTTCTGCTACTCACCGG + Intergenic
1010383375 6:75249440-75249462 ATCCTGAATCTGCCATTTAGTGG + Intronic
1010777198 6:79901051-79901073 GTCCTGGCTCTGACACCTATGGG - Intergenic
1010942633 6:81936630-81936652 ATACTGCTTCTGCCACATATAGG + Intergenic
1011742006 6:90371351-90371373 GCCCTGGTTCTGCGACTTATTGG - Intergenic
1011743288 6:90385035-90385057 ATCCTGGCTCTGCCATTTACTGG + Intergenic
1011751066 6:90455168-90455190 AGCCTGGCTCTACCACTTACTGG + Intergenic
1011823710 6:91281852-91281874 ATCCAGGCTTTGCCACTTCTTGG + Intergenic
1012298906 6:97559774-97559796 ATCCTTGCTCTGCCACTGTTTGG + Intergenic
1013260498 6:108436714-108436736 ATCCTGGTTCTGTCACTTTTGGG + Intronic
1013496999 6:110707392-110707414 ATGCCTGTTCTGCCATTTATTGG - Intronic
1014745586 6:125196847-125196869 ATGCTGGATCTGCAACTAATTGG - Intronic
1016263306 6:142200995-142201017 ATCCTGGTTCTGTCATTACTGGG - Intronic
1016375542 6:143416907-143416929 ATTCTGGTTCTGCTACTCACTGG + Intergenic
1016706290 6:147111927-147111949 ATTCTGATTCTGCCACTTTCTGG + Intergenic
1016888422 6:148981327-148981349 ATCCTGGTTTTATCACTTAATGG - Intronic
1017058713 6:150460706-150460728 GTCCTGGCTCTGCTACTTATGGG - Intergenic
1017440660 6:154461787-154461809 ATCCTGACTCTGCCTATTATTGG - Intronic
1017659780 6:156662423-156662445 ATCCACGTTCTCCCACATATGGG - Intergenic
1018001195 6:159580057-159580079 ATCCTGGTTCCACCACCTATTGG - Intergenic
1018617505 6:165702087-165702109 AACATGGTTTTGCCACTTACGGG - Intronic
1018668388 6:166160529-166160551 ATCCTGGTTCTGCCACTTACTGG - Intronic
1019790051 7:3005895-3005917 AACCTGGCTCTACCACTTACTGG + Intronic
1020718072 7:11703404-11703426 ATTCTGATGCTGCCACTTATTGG - Intronic
1020806138 7:12792586-12792608 ATCCTGAGTCTTCCACTAATGGG - Intergenic
1020882404 7:13778648-13778670 AATCTGATTCTGTCACTTATTGG - Intergenic
1021846844 7:24771541-24771563 ATCCTGGTTCTGCCACTTACTGG + Intergenic
1021895559 7:25231956-25231978 ACCCTGGTTCTGACACTTACTGG - Intergenic
1021936826 7:25639310-25639332 ACCCTGGCTCTGCTGCTTATTGG + Intergenic
1022032598 7:26505913-26505935 ATGCTGGCTCTACCACTTACAGG + Intergenic
1022208872 7:28188878-28188900 TTCCTGGTTCTAACACTTCTTGG + Intergenic
1022412950 7:30153538-30153560 ATCCTGGCTCTGCCACTTACTGG + Intronic
1022508900 7:30922914-30922936 ATCCTGGCTCAGCCACTTTCGGG + Intronic
1022543830 7:31166596-31166618 ATCCTCTTTCTACAACTTATGGG - Intergenic
1022620548 7:31979567-31979589 ATCCTGGCTCTGCCATTTACTGG - Intronic
1023008508 7:35902650-35902672 GTCCTGGTTCTTCCACTTTCTGG + Intronic
1023016432 7:35972028-35972050 GTCCTGGTTCTTCCACTTTCTGG + Intergenic
1023122043 7:36919484-36919506 AACCTGGTTCTCTCACTTATGGG + Intronic
1023134403 7:37036836-37036858 ATCCTGGTGCTATCACTTTTGGG - Intronic
1023344919 7:39261625-39261647 ATCCCGCCTCTGCCACTTACAGG - Intronic
1023473996 7:40556631-40556653 ATCCCAGTTCTACCACTTAGTGG + Intronic
1023640479 7:42251767-42251789 ATTCTAGTTTTGCCAATTATTGG - Intergenic
1024486074 7:49921474-49921496 ATCCCAGTTCTACCACTTACTGG + Exonic
1024499701 7:50091894-50091916 ATCCTAATTCTGCCACTTACTGG + Intronic
1025225618 7:57158901-57158923 ATCCTGGTTCTGACACTTATGGG - Intergenic
1025256365 7:57386177-57386199 ATCCTGGCTCTGCCTCTCCTTGG + Intergenic
1025267715 7:57478522-57478544 ATCCTGGTTCTGTCACTTATGGG + Intergenic
1025749077 7:64275674-64275696 ATCCTGGTTCTGCCACTTATGGG + Intergenic
1025794912 7:64730387-64730409 ATCCCAGTTCTGCCACTTATGGG + Intergenic
1025820498 7:64958468-64958490 ATTCCAGTTCTGCCATTTATGGG - Intergenic
1026232802 7:68499963-68499985 ATCCTGGCTCTGTCTCTTACTGG + Intergenic
1026291314 7:69008705-69008727 ATCTTGGTTCTGCCACTGATAGG + Intergenic
1026332224 7:69362337-69362359 AGCTTGGTTCTGCCACTATTAGG - Intergenic
1026397533 7:69971257-69971279 ATTCTGCTTCTGCCATTTACTGG + Intronic
1026455325 7:70567418-70567440 ATCCTGGTTCTGCCACTCTCTGG + Intronic
1026673189 7:72407174-72407196 ATCCTGGCTGTGCCACTTAGGGG + Intronic
1027194538 7:76020574-76020596 ATCCTGGCCCCACCACTTATAGG + Intronic
1027462464 7:78471992-78472014 ATCCTGGTTTTGCCATTTACTGG - Intronic
1028602663 7:92618944-92618966 ATCCTGCACCTGCCACTTACTGG + Intronic
1028835264 7:95367707-95367729 ATCTTGGCTCTGCCACTTTGTGG - Intronic
1030511388 7:110486705-110486727 AGTCTAGTTCTGCCACTTACTGG + Intergenic
1031020088 7:116618428-116618450 ATCCTGGCTCTGACACTTACTGG + Intergenic
1031076260 7:117215756-117215778 ATCCTGCTTCTGGCACTTGGTGG + Intronic
1031857387 7:126938890-126938912 ATCCTAGTTCTCCCAATTACAGG + Intronic
1031999695 7:128256750-128256772 GTCCTGGTCCTGCCACCTGTTGG - Exonic
1032024706 7:128431710-128431732 GTCCTGATTCTGCCATTTTTGGG + Intergenic
1032595342 7:133234073-133234095 ATCCTTTTTCTGCCACTTACTGG - Intergenic
1033637673 7:143226992-143227014 GTCCTGGCTCTGCCACTTACTGG + Intergenic
1033962823 7:146934801-146934823 TTCCAGGCTCTGCCTCTTATTGG + Intronic
1034189547 7:149203331-149203353 ATCCTGACTTTGCCACTTACTGG + Intronic
1034872935 7:154699769-154699791 TGCCTAGTTCTGCCCCTTATGGG + Intronic
1035616477 8:1005863-1005885 GTTCTGGTTCTGCCAGTCATGGG - Intergenic
1036469949 8:9044010-9044032 ATCTTGGTTCTGAGACTTACTGG + Intronic
1036613448 8:10370245-10370267 ATCCTTCCTTTGCCACTTATTGG - Intronic
1037136553 8:15469726-15469748 ATCTTGGTTCTTCCAAGTATTGG - Intronic
1037276107 8:17180729-17180751 ATCCTGCCTCTGCCACTTGCTGG - Intronic
1037493001 8:19413199-19413221 ATCCAGGTTCTGCCATTTCCAGG + Intronic
1037626257 8:20609655-20609677 ATCCTGGTTCTGTCCCTTGGTGG - Intergenic
1037728316 8:21502560-21502582 GTCCTGGTTCTTCCACTCAGGGG - Intergenic
1038494826 8:27993960-27993982 ATACTAGCTCTGCCACTTACTGG - Intergenic
1038793098 8:30686050-30686072 ATCCTAGCTCTGCAACTTACCGG + Intronic
1039379782 8:37074449-37074471 ATCCTGGGTCTGCCCCTTTCTGG + Intergenic
1039518231 8:38150658-38150680 ATCCTAGTTGTGCCTCTTACTGG - Intronic
1040124897 8:43726149-43726171 TTGCTGGTTTTGCCACTTGTGGG + Intergenic
1040390978 8:46950353-46950375 ATCCCTGTTCTGCCCCTCATAGG - Intergenic
1040604463 8:48916851-48916873 ATACAGGTTCTGGCATTTATTGG + Intergenic
1042003798 8:64157672-64157694 GTTCTGGCTCTGCCACTTTTAGG - Intergenic
1042325460 8:67523081-67523103 ATCCCAGCTCTGCCACTTGTAGG + Intronic
1042577550 8:70237266-70237288 ATCCTGCTTCTGCCAGCTGTTGG - Intronic
1042821514 8:72935117-72935139 ACCCTGGCTTTACCACTTATTGG - Intronic
1043127078 8:76412435-76412457 ATCTGGATTCTGCCATTTATAGG - Intergenic
1043762520 8:84085534-84085556 CTCCTGGCTATGCCTCTTATTGG - Intergenic
1043959327 8:86397969-86397991 ATTCCAGTTCTGCTACTTATTGG - Intronic
1044092668 8:88021738-88021760 ACCCAGGTTCTGCTACATATGGG - Intergenic
1044289499 8:90451215-90451237 GTCCTGGTCCTTCCACTTATTGG - Intergenic
1044906672 8:97011595-97011617 ATCCTGGCTCTGACACTTATTGG + Intronic
1045166783 8:99615316-99615338 ATCCTGGCGCTACCACTTACTGG + Intronic
1045238271 8:100375253-100375275 ATCCTACTTTTGCCACTTAGTGG - Intronic
1046764466 8:118054664-118054686 ATCCTGGTTTTCCCACTCCTTGG - Intronic
1046861656 8:119099523-119099545 ATCCTGGCTTTGCCACTTACTGG - Intronic
1047227679 8:122970515-122970537 ATCCAGGATCTGCCACTTCCTGG - Intronic
1047281197 8:123447590-123447612 ATCCTGGCTCTACTACTTACTGG - Intronic
1047305145 8:123646482-123646504 ATCCTGGCTCTGTCACTAACTGG - Intronic
1047722326 8:127652616-127652638 ATCCTGGTTCTGCAATTTACTGG + Intergenic
1047765144 8:127984393-127984415 ATCCTAGCTCTGCCACTTGCTGG - Intergenic
1047922051 8:129645348-129645370 TTCCTGACTCTGCCACATATTGG + Intergenic
1048048824 8:130797964-130797986 ATCTTGGCTTTGCCACTTAGTGG + Intronic
1048186644 8:132248037-132248059 ATCCTAGCTCTGCCACTTCCTGG - Intronic
1048273683 8:133049543-133049565 ATCCTGCCTCTGTCACTTACTGG - Intronic
1048335479 8:133499115-133499137 ATCCCAGCTCTGCCACTTACCGG + Exonic
1048643562 8:136391904-136391926 TTCCTGGTTCTCCACCTTATAGG - Intergenic
1049199354 8:141332391-141332413 ATCCTGCTTCTGCCACAAGTTGG - Intergenic
1050285094 9:4093178-4093200 ATCATGACTCTGCCACTTACAGG - Intronic
1050301952 9:4268139-4268161 ATCCTGACTCTGCCACTTACAGG + Intronic
1050336765 9:4597132-4597154 ATCCTAGTTCTGCCATTTACAGG - Intronic
1050360018 9:4821310-4821332 ATCCTGGTTTTGCCACTTTCTGG + Intronic
1050463412 9:5896137-5896159 ATGTTGGTTCTGCCACTTGCTGG + Intronic
1050661394 9:7886712-7886734 ATCCTGGGTCTGCCACACACTGG + Intronic
1050871812 9:10581036-10581058 TTCTTGGTTCTGCCACTTCTCGG + Intronic
1051042003 9:12823196-12823218 ATCCTGGCTTTGACACTTACTGG - Intergenic
1051147550 9:14043477-14043499 ATCTTGATTCTACCACTTAAAGG + Intergenic
1051255580 9:15209579-15209601 GTCCTGGTTCTTCCACTTTTAGG + Intronic
1051590490 9:18772524-18772546 ATCCTGACTCTGCCACTTACTGG + Intronic
1051640566 9:19221069-19221091 AGCCTGGTTCTGCTTTTTATTGG - Intergenic
1051746142 9:20297129-20297151 ATCCTTGCTCTCCCACTTGTTGG - Intergenic
1052843303 9:33312245-33312267 ATCCTGGTTCTGTCACTTACTGG + Intronic
1053372588 9:37575567-37575589 ATCACAGTTCTGCCACTTACTGG - Intronic
1054967163 9:71042509-71042531 AGCGTGTTCCTGCCACTTATGGG - Intronic
1055053388 9:72001426-72001448 AACCTAGTGCTGCCACTGATAGG + Intergenic
1055122514 9:72678172-72678194 ATCTTGGTTATGCCACTTATTGG + Intronic
1055743215 9:79412371-79412393 ATCCTGGCCCTGCCACTTACTGG + Intergenic
1056620788 9:88212209-88212231 ATTCTGGTTTTGCCACTTAACGG + Intergenic
1057539592 9:95954141-95954163 ATCCTGACCCTGCCACTTATTGG - Intronic
1057824087 9:98358933-98358955 ATCCAGGCTCTGCCACTCACTGG + Intronic
1057983741 9:99688397-99688419 ATTCTGGTTCTGCCACTTATTGG - Intergenic
1058418411 9:104811854-104811876 ATCCTGACTTTGCTACTTATTGG - Intronic
1058733532 9:107873487-107873509 ATCTTGGTTCTGCCACTACCAGG + Intergenic
1058860247 9:109110395-109110417 ATCCTGCCTCTGTCATTTATTGG - Intronic
1058887293 9:109331084-109331106 ATCCTGGCTGTGACACTTCTTGG + Intergenic
1058951550 9:109908424-109908446 ATCCCAGCTCTGCCACTTACTGG + Intronic
1059203679 9:112443403-112443425 ATCTTGGTTCTGCCACCTGCTGG - Intronic
1059457013 9:114406181-114406203 ATCCCGGCTCTGCCACTGACTGG - Intronic
1059739219 9:117133372-117133394 ATCCTAGCTCTGCCACTGACTGG - Intronic
1059801211 9:117751277-117751299 ATTTTGGTTCTGCCACTTTATGG - Intergenic
1059806484 9:117806504-117806526 ATTCTGGCTCTGTCACTTGTTGG + Intergenic
1060055596 9:120410173-120410195 ATTCTGGTTCTGCCACCTACTGG - Intronic
1060074185 9:120577249-120577271 CTCATGGTTCAGCCACTTAGTGG - Intronic
1060246219 9:121948669-121948691 AGCCTGGTTCTGCCACTTCCTGG - Intronic
1060304979 9:122403292-122403314 GTCCAGGTTCTACCACTTACGGG - Intergenic
1060454970 9:123783648-123783670 ATCCTGGCTCTGCCATTTACAGG - Intronic
1060665926 9:125432131-125432153 ATCCTAGTGCTGCCACTTGCTGG - Intergenic
1060741384 9:126099763-126099785 CTCCTGGCTCTGCCACTTCCTGG + Intergenic
1060802164 9:126551589-126551611 ATCCTGGCGCAGCCACTTGTTGG + Intergenic
1061048407 9:128179988-128180010 ATGCTGGCTCTACCACTTACAGG + Intronic
1061282114 9:129603291-129603313 ATCCTGGCTTTGCCACTTCCTGG + Intergenic
1061384557 9:130281246-130281268 ATCCCAGCACTGCCACTTATTGG + Intergenic
1061527242 9:131176238-131176260 GTCTGGGTTCTGCTACTTATTGG - Intronic
1061720370 9:132547416-132547438 CTCATGGAGCTGCCACTTATAGG - Intronic
1061750495 9:132773681-132773703 ATCCTGGCTTTGCCATCTATGGG - Intronic
1062218430 9:135401662-135401684 ATCCTGGCCCTGCCACTTACAGG - Intergenic
1185522203 X:748845-748867 ATCCTGGAATAGCCACTTATTGG + Intergenic
1186627756 X:11313154-11313176 ATTCTGGCTTTGCCTCTTATAGG - Intronic
1186830608 X:13386481-13386503 GTCCTGGTTCTGCTACTAACTGG - Intergenic
1187211607 X:17237649-17237671 GTCCTGCTTCTGCCACTTTGGGG + Intergenic
1187248816 X:17578441-17578463 ATTCTGTCTCTGCCACCTATAGG + Intronic
1187941894 X:24390701-24390723 TTGCTGGCTCTGCCACTTACTGG + Intergenic
1188585753 X:31772701-31772723 ATCCTTGTTCTGCTACTTACTGG + Intronic
1188995045 X:36873829-36873851 ATCCTCTTTCTGCCATTTTTTGG - Intergenic
1189130418 X:38492299-38492321 AACTTGGTTCTGCCACTTAACGG + Intronic
1189167286 X:38872722-38872744 ATCCCAGCACTGCCACTTATTGG - Intergenic
1189288684 X:39870195-39870217 ATCCAGGCTCTGCCACTAACTGG - Intergenic
1189498385 X:41530138-41530160 CTCCTGGGTCTGCCATTTCTAGG - Intronic
1189969536 X:46404250-46404272 GTCTTGGTTTTGCCACTTATTGG + Intergenic
1190172843 X:48125370-48125392 CTCCTGGTTCTTTTACTTATTGG + Intergenic
1190337716 X:49272353-49272375 ATCCTGGCGCTGCCACTTACTGG + Intronic
1190734567 X:53247566-53247588 ATCCTGGCTCTGCCACTTTAGGG - Intronic
1191654564 X:63582024-63582046 ATCCTGGTTCTTCGACTTAGAGG + Intergenic
1191678148 X:63813302-63813324 ATCCCAGATCTGCCACTTACTGG + Intergenic
1191732938 X:64356879-64356901 ATTCTGTTTGTGCCACTTCTTGG - Intronic
1193207358 X:78764993-78765015 GTCTTGGTTTTGCCACTTATTGG - Intergenic
1193722814 X:85006382-85006404 AACCTAGTTCTTCCACTTAGTGG - Intronic
1195457650 X:105087183-105087205 ATCTTCATCCTGCCACTTATTGG + Intronic
1195535760 X:106007742-106007764 ACCTTGGTTCTACCACTTACTGG - Intergenic
1196282772 X:113842612-113842634 ATCCCAGCTCTGCCACTTACTGG + Intergenic
1196749460 X:119101836-119101858 ATCCTAGCTATACCACTTATTGG + Intronic
1196798273 X:119520013-119520035 GTCCTGGCTCTGTCACTTACTGG - Intergenic
1196928838 X:120661063-120661085 ATCCTAGCTCTGCAACATATTGG - Intergenic
1196983444 X:121241185-121241207 ATTCAGGCTCTGCCACTAATTGG + Intergenic
1197772033 X:130095219-130095241 ACCCCGGCTCTGCCACTTACTGG - Intronic
1198015393 X:132605224-132605246 ATCCTGGCCCTGCCACTCACTGG - Intergenic
1198089760 X:133316325-133316347 ATCCTGGTTTGGCCATTTACTGG - Intronic
1198373584 X:136015442-136015464 ATCCTGGTTCTACTACTTGCTGG + Intronic
1198477966 X:137014157-137014179 ATCATGGCTCTACCACTTACTGG - Intergenic
1198637486 X:138715257-138715279 ATCCTATCTCTGCCACTAATTGG + Intronic
1198739960 X:139831737-139831759 ATTCAGGTTCTTCCATTTATAGG + Intronic
1198816259 X:140594266-140594288 AGCCTGGCTCTGCCACTCACTGG - Intergenic
1198829277 X:140731458-140731480 ATTCTGTCTCTGCCACTTACTGG + Intergenic
1199164047 X:144648760-144648782 ATGCTGCTGCTGCCACATATGGG + Intergenic
1199907415 X:152247502-152247524 ATACCAGCTCTGCCACTTATTGG + Intronic