ID: 1174576089

View in Genome Browser
Species Human (GRCh38)
Location 20:51538495-51538517
Sequence ATCATGTAACACTCTACTGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 132
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 124}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1174576085_1174576089 6 Left 1174576085 20:51538466-51538488 CCAAGGCAAGGATGCCCACTGTC 0: 1
1: 2
2: 17
3: 82
4: 269
Right 1174576089 20:51538495-51538517 ATCATGTAACACTCTACTGGAGG 0: 1
1: 0
2: 0
3: 7
4: 124
1174576086_1174576089 -8 Left 1174576086 20:51538480-51538502 CCCACTGTCTTCACTATCATGTA 0: 1
1: 0
2: 0
3: 16
4: 153
Right 1174576089 20:51538495-51538517 ATCATGTAACACTCTACTGGAGG 0: 1
1: 0
2: 0
3: 7
4: 124
1174576087_1174576089 -9 Left 1174576087 20:51538481-51538503 CCACTGTCTTCACTATCATGTAA 0: 1
1: 0
2: 1
3: 27
4: 224
Right 1174576089 20:51538495-51538517 ATCATGTAACACTCTACTGGAGG 0: 1
1: 0
2: 0
3: 7
4: 124
1174576083_1174576089 12 Left 1174576083 20:51538460-51538482 CCTCCTCCAAGGCAAGGATGCCC 0: 1
1: 0
2: 1
3: 38
4: 253
Right 1174576089 20:51538495-51538517 ATCATGTAACACTCTACTGGAGG 0: 1
1: 0
2: 0
3: 7
4: 124
1174576084_1174576089 9 Left 1174576084 20:51538463-51538485 CCTCCAAGGCAAGGATGCCCACT 0: 1
1: 0
2: 3
3: 22
4: 144
Right 1174576089 20:51538495-51538517 ATCATGTAACACTCTACTGGAGG 0: 1
1: 0
2: 0
3: 7
4: 124
1174576080_1174576089 25 Left 1174576080 20:51538447-51538469 CCAACACTGGAGTCCTCCTCCAA 0: 1
1: 1
2: 1
3: 11
4: 153
Right 1174576089 20:51538495-51538517 ATCATGTAACACTCTACTGGAGG 0: 1
1: 0
2: 0
3: 7
4: 124

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1174576089 Original CRISPR ATCATGTAACACTCTACTGG AGG Intronic
903357329 1:22756226-22756248 ATCATGTCACTCCCTACTCGTGG - Intronic
908725678 1:67174266-67174288 ATCCTCTAACACACTTCTGGTGG - Intronic
913100535 1:115560100-115560122 ATTACGTAGCACACTACTGGGGG - Intergenic
913205094 1:116531536-116531558 ATTATGTAACACTCAAAAGGTGG + Intronic
913564913 1:120063449-120063471 CTCAGGTAACATTCTAATGGAGG + Intronic
913633217 1:120730114-120730136 CTCAGGTAACATTCTAATGGAGG - Intergenic
913861682 1:123794324-123794346 ATCATGAAACACTCTTTTTGTGG + Intergenic
914285499 1:146222799-146222821 CTCAGGTAACATTCTAATGGAGG + Intronic
914327401 1:146633320-146633342 ATCATATAACATTGTCCTGGAGG + Intergenic
914546530 1:148673554-148673576 CTCAGGTAACATTCTAATGGAGG + Intronic
914620035 1:149397116-149397138 CTCAGGTAACATTCTAATGGAGG - Intergenic
919663071 1:200266975-200266997 ACCATGTTACTCTCTACTGAGGG - Intergenic
921121395 1:212140548-212140570 CTCATGTTACATTCTAGTGGAGG - Intergenic
1065504136 10:26412183-26412205 ACAATGTAACACTCTAATGTAGG + Intergenic
1066750843 10:38655122-38655144 ATCCTTTAATACTCTAATGGTGG + Intergenic
1066966201 10:42267990-42268012 ATCTTTTAATACTCTAATGGTGG - Intergenic
1071708400 10:88024641-88024663 GTCATGTAACAGTCTATTGAGGG + Intergenic
1071908097 10:90197411-90197433 ATCATCTAACATTCTACCAGGGG + Intergenic
1075560257 10:123462945-123462967 TTCATTTAACAGTCTACTGTGGG + Intergenic
1078847681 11:15135197-15135219 ATCATAGAACACTCTGTTGGTGG + Intronic
1080522431 11:33079082-33079104 AACATGTAACCCTCTACCTGTGG + Intronic
1081076624 11:38682652-38682674 ATCTTGTAACTTTCTACTGTTGG + Intergenic
1086525237 11:87717019-87717041 TTAATTTAACACTCTACTGGAGG + Intergenic
1095513023 12:42974387-42974409 ATGAAGTAGCACACTACTGGGGG + Intergenic
1096589530 12:52648463-52648485 ATCATGTAACCGTCTACTCCTGG + Intronic
1096769336 12:53924318-53924340 ATAATGAAACACTCTGATGGTGG - Intergenic
1097933942 12:65224142-65224164 ATACTGTAACACTGTAATGGTGG - Intronic
1099241380 12:80143217-80143239 ATTATGTAACACTCTATAGTGGG - Intergenic
1100911758 12:99372171-99372193 CACATGTACCACTCTAGTGGGGG + Intronic
1101275132 12:103191361-103191383 ATCATGTAATACTGTAATGGTGG + Intergenic
1101585447 12:106081692-106081714 ATCATGTAATTCCCTAATGGAGG - Intronic
1104203653 12:126616315-126616337 CACATGTAATACTCTTCTGGTGG + Intergenic
1107371900 13:39760257-39760279 ATCATTTTACATTCCACTGGAGG - Intronic
1108097216 13:46915721-46915743 ATAATGTACCACTCTGGTGGGGG - Intergenic
1109316530 13:60756007-60756029 ATAATGTAACACACAACTAGAGG - Intergenic
1109647962 13:65285277-65285299 ATCATGTAGCACCATGCTGGTGG - Intergenic
1111489102 13:88946047-88946069 AACATGGACCAATCTACTGGAGG + Intergenic
1112028315 13:95433332-95433354 TTCATGTAACACTGTATTTGAGG - Intergenic
1113086482 13:106574340-106574362 ATCAGGGAACATTCTTCTGGAGG + Intergenic
1113141297 13:107153893-107153915 ATCTTGTAATACTGTACTGATGG - Intergenic
1114967282 14:27978707-27978729 ATTATGTAAAACTCTACTGCTGG + Intergenic
1115673333 14:35641210-35641232 ATCATTTGACACAGTACTGGAGG + Intronic
1120196321 14:81487389-81487411 ATCATGTCACACTGCAGTGGAGG - Exonic
1122368139 14:101209475-101209497 ATAATGTAATACTGTAATGGAGG - Intergenic
1123265178 15:17710838-17710860 ATTATGAAACACTCTTTTGGAGG + Intergenic
1123272490 15:17839091-17839113 ATTATGAAACACTCTTTTGGAGG + Intergenic
1123280286 15:17976214-17976236 ATTATGAAACACTCTTTTGGAGG + Intergenic
1123280483 15:17979629-17979651 ATTATGAAACACTCTTTTGGAGG + Intergenic
1123284637 15:18052885-18052907 ATTATGAAACACTCTTTTGGAGG + Intergenic
1123285997 15:18076788-18076810 ATTATGAAACACTCTTTTGGAGG + Intergenic
1123288339 15:18117770-18117792 ATTATGAAACACTCTTTTGGAGG + Intergenic
1123495761 15:20823790-20823812 ATCATATAGCAGTCTACTGCTGG + Intergenic
1123552247 15:21392882-21392904 ATCATATAGCAGTCTACTGCTGG + Intergenic
1123588491 15:21830279-21830301 ATCATATAGCAGTCTACTGCTGG + Intergenic
1125278519 15:38019580-38019602 ATAATGTACCACTCTAGTGGGGG - Intergenic
1126704253 15:51392946-51392968 TTTATTTAACATTCTACTGGAGG - Intronic
1128755070 15:70177627-70177649 ATTATGTAACACTATTCTGTGGG - Intergenic
1130716375 15:86338932-86338954 AGGATGTAACCCTCTACTAGAGG + Intronic
1202960595 15_KI270727v1_random:120115-120137 ATCATATAGCAGTCTACTGCTGG + Intergenic
1136731876 16:32421996-32422018 ATCCTTTAATACTCTAATGGTGG - Intergenic
1138671912 16:58622316-58622338 AAAATGTACCACTCTAGTGGGGG + Intronic
1140006159 16:71077620-71077642 ATCATATAACATTGTCCTGGAGG - Intronic
1202994517 16_KI270728v1_random:95253-95275 ATCCTTTAATACTCTAATGGTGG + Intergenic
1203021204 16_KI270728v1_random:407595-407617 ATCCTTTAATACTCTAATGGTGG + Intergenic
1147506510 17:41023002-41023024 AAAATGTATCACTCTAGTGGGGG - Intergenic
1150693189 17:67381893-67381915 CTCATTTAACACTCTGGTGGTGG + Intronic
1153778927 18:8477472-8477494 AACATTTAACAATCTACTGTCGG - Intergenic
1154270503 18:12914212-12914234 ATCATTTAATACTATACTTGTGG + Intronic
1155313490 18:24547774-24547796 GTATTGTAACACTCTTCTGGTGG - Intergenic
1156395712 18:36698083-36698105 TTCATGAAACACTGAACTGGAGG - Intronic
1159608283 18:70498011-70498033 CACATGTACCACTCTGCTGGTGG - Intergenic
1165877169 19:39016319-39016341 AACATGTACCACTCTGGTGGGGG + Intronic
1167297418 19:48659790-48659812 ATTATGTAACATTTTATTGGTGG + Intergenic
925511544 2:4631663-4631685 AACAAGTAACAATGTACTGGAGG + Intergenic
932546787 2:72720080-72720102 ATCTTATCACAGTCTACTGGAGG - Intronic
933625276 2:84590768-84590790 ATTGTGTAACACTGTGCTGGGGG - Intronic
934313844 2:91897280-91897302 ATCCTTTAATACTCTAATGGTGG + Intergenic
937738812 2:125323908-125323930 ATAATCTAATACTCTAATGGTGG + Intergenic
942770368 2:179510931-179510953 ATTATGTAACATTCTCCTAGGGG - Intronic
942909785 2:181229183-181229205 ATCATGTAACACTTTTCTCAGGG - Intergenic
947471534 2:230405409-230405431 ATCATTTTACTCACTACTGGGGG - Intergenic
1168946794 20:1767634-1767656 AACATGTAACAGTGTATTGGGGG + Intergenic
1169904454 20:10587437-10587459 AGTATTCAACACTCTACTGGAGG + Intronic
1169950532 20:11038509-11038531 ATTATGTCACAATCTACTGGAGG - Intergenic
1174576089 20:51538495-51538517 ATCATGTAACACTCTACTGGAGG + Intronic
1174661416 20:52216334-52216356 ATCATGTAATCCTGTAATGGTGG - Intergenic
1177165824 21:17602112-17602134 AGTATTTAACACTCTATTGGGGG + Intronic
1177519542 21:22200856-22200878 ATCATGTGGCACTGTACTGAGGG + Intergenic
1179941770 21:44644188-44644210 ATCATGGAACTTTCCACTGGGGG - Intronic
1181348241 22:22236309-22236331 AGCAGGTCACAGTCTACTGGTGG + Intergenic
1181601743 22:23956618-23956640 ATCATGTGCCACTCTATCGGGGG - Intergenic
1181606760 22:23984686-23984708 ACCATGTGCCACTCTATTGGGGG + Intergenic
1184055119 22:42041734-42041756 ATAATATAACACTGTAATGGTGG - Intronic
1185170961 22:49294329-49294351 ATAATGTAGCACTCTAATGATGG + Intergenic
950953550 3:17027212-17027234 ATCATGTAACATTTTAGAGGAGG + Intronic
957901762 3:86503353-86503375 TACATGTACCACTCTAATGGAGG - Intergenic
958571676 3:95892305-95892327 ATATTGTAACACTTTAATGGTGG - Intergenic
966998178 3:185305532-185305554 ATCATGTAATACTGTAATGATGG - Intronic
967357054 3:188583348-188583370 ATCATGTGACTCTCCAGTGGTGG - Intronic
970455687 4:16221426-16221448 ATCATGTAAAAATATGCTGGAGG - Intronic
970751974 4:19374696-19374718 ATGATTTAACACTATTCTGGAGG - Intergenic
971229726 4:24791427-24791449 GTCATGGTACACTCTACTTGGGG - Intronic
975168803 4:71209331-71209353 AATGTGTAACAGTCTACTGGGGG + Intronic
976041286 4:80887683-80887705 ATTATGTAACACTGTAATTGTGG + Intronic
981495332 4:145385571-145385593 CTCCTGTGACACTCCACTGGTGG + Intergenic
1001792788 5:174474021-174474043 ATAATATAACACTTTAATGGTGG + Intergenic
1002272871 5:178084166-178084188 ATCATGTAAAACTCTGCCCGAGG - Intergenic
1009803031 6:68566954-68566976 GTAATGTACCACTCTGCTGGGGG - Intergenic
1012256185 6:97035369-97035391 ATAATGTAACACTGTAATGGTGG - Intronic
1012520826 6:100119119-100119141 ATCATGTAATTCTCTAAAGGTGG - Intergenic
1016351004 6:143167381-143167403 ATCATTTCACATTCAACTGGAGG - Intronic
1017285155 6:152666360-152666382 ATAATGTAACACTGTCGTGGTGG - Intergenic
1021757759 7:23871184-23871206 AATATGTCACACTCTAATGGAGG + Intergenic
1026841488 7:73671768-73671790 ATGATGTAAAACACTCCTGGCGG - Exonic
1030290524 7:107867657-107867679 AACATGTACCACTCTTGTGGGGG + Intergenic
1030660898 7:112218230-112218252 ATCAGGTAACAATGTACTGGAGG + Intronic
1031225329 7:119029847-119029869 CTAATGTACCACTCTAGTGGGGG + Intergenic
1035702250 8:1645295-1645317 TTCATGGAACACTGTACTGAAGG - Intronic
1037035756 8:14164464-14164486 ATTATGTAAGACTCTACTTTAGG + Intronic
1037085858 8:14849204-14849226 AACTTCTTACACTCTACTGGTGG + Intronic
1046000148 8:108410675-108410697 ATCATGGAAGATTCTACTGAAGG - Intronic
1046330328 8:112706045-112706067 ACAATGTAACAGTCTACTTGAGG + Intronic
1050333950 9:4572847-4572869 ATTATTTAATACTCTAGTGGTGG - Intronic
1051288167 9:15517410-15517432 AAAATGTAACACTTTAGTGGGGG - Intergenic
1060051319 9:120380309-120380331 ACAATATAACACTCTAATGGTGG + Intergenic
1060761298 9:126251877-126251899 ATTATGAAACACTCAAATGGTGG + Intergenic
1062486980 9:136783028-136783050 ATCTTGTAACACTGTAATGACGG + Intergenic
1193838673 X:86379886-86379908 ATCATGTAACAGATTACTTGTGG - Intronic
1196021237 X:110992993-110993015 ATCTTGCAACCCTCTTCTGGAGG + Intronic
1197026808 X:121760759-121760781 ATAATGTAATACTGTATTGGTGG + Intergenic
1201181754 Y:11354771-11354793 ATCCTTTAATACTCTAATGGTGG + Intergenic
1202072323 Y:21005058-21005080 ATGATGTGACTCTCTACTGCTGG - Intergenic