ID: 1174578814

View in Genome Browser
Species Human (GRCh38)
Location 20:51556519-51556541
Sequence CCGGGTACTTTCCAAGATGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 128
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 119}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1174578814_1174578822 22 Left 1174578814 20:51556519-51556541 CCAGCATCTTGGAAAGTACCCGG 0: 1
1: 0
2: 0
3: 8
4: 119
Right 1174578822 20:51556564-51556586 CTTGGTGAAAACACATTAAATGG No data
1174578814_1174578818 4 Left 1174578814 20:51556519-51556541 CCAGCATCTTGGAAAGTACCCGG 0: 1
1: 0
2: 0
3: 8
4: 119
Right 1174578818 20:51556546-51556568 TGATAGATCCCCAAACATCTTGG No data
1174578814_1174578824 29 Left 1174578814 20:51556519-51556541 CCAGCATCTTGGAAAGTACCCGG 0: 1
1: 0
2: 0
3: 8
4: 119
Right 1174578824 20:51556571-51556593 AAAACACATTAAATGGTCAAGGG 0: 1
1: 0
2: 2
3: 39
4: 397
1174578814_1174578825 30 Left 1174578814 20:51556519-51556541 CCAGCATCTTGGAAAGTACCCGG 0: 1
1: 0
2: 0
3: 8
4: 119
Right 1174578825 20:51556572-51556594 AAACACATTAAATGGTCAAGGGG 0: 1
1: 0
2: 1
3: 18
4: 258
1174578814_1174578823 28 Left 1174578814 20:51556519-51556541 CCAGCATCTTGGAAAGTACCCGG 0: 1
1: 0
2: 0
3: 8
4: 119
Right 1174578823 20:51556570-51556592 GAAAACACATTAAATGGTCAAGG 0: 1
1: 0
2: 5
3: 77
4: 1023

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1174578814 Original CRISPR CCGGGTACTTTCCAAGATGC TGG (reversed) Intronic
900585168 1:3429132-3429154 CCGGGTTCCTTCCAAGACTCTGG - Intronic
902679533 1:18033405-18033427 GTGGGCACTTTCCAAGGTGCGGG - Intergenic
903716721 1:25373236-25373258 CCGGGTACTTTGCAAGACAGAGG + Intronic
910852171 1:91659207-91659229 CCAGGTACTGTTCTAGATGCTGG - Intergenic
917566375 1:176216285-176216307 CCAGGTACTTTACTGGATGCTGG - Intergenic
923465460 1:234244332-234244354 CCGGGCACTGTGCAAGGTGCTGG - Intronic
923749576 1:236735223-236735245 CAGGTCACTTTGCAAGATGCGGG - Intronic
1065676410 10:28179256-28179278 GGGGGTATTTTCCAAGATTCTGG - Intronic
1066012006 10:31203064-31203086 CAGGGCACTTTCCTAGGTGCTGG - Intergenic
1068300933 10:55138016-55138038 GCAGGTACTTTTCTAGATGCAGG + Intronic
1069192572 10:65508264-65508286 CAGGGCTCTTTCAAAGATGCAGG + Intergenic
1074464670 10:113670810-113670832 CCAGGTACATTCCAAGAACCTGG + Intergenic
1076216840 10:128701687-128701709 CCTGAAACTTTCCCAGATGCAGG - Intergenic
1076520556 10:131078309-131078331 CCGGGTCCTTTCCCAGGTGATGG + Intergenic
1080344676 11:31311241-31311263 CTAGGTACTTTCCCATATGCAGG - Intronic
1086070550 11:82794770-82794792 CAGGCTACTTTCCAACATCCTGG + Intergenic
1086918292 11:92556613-92556635 CGCGGTACTCTCCAAGGTGCTGG + Intronic
1092373631 12:7937371-7937393 TCAGGTACTCTCCAAGAAGCTGG + Intergenic
1093959166 12:25253607-25253629 CTGGGTACTTTCTTAGAAGCCGG + Intergenic
1096411767 12:51382213-51382235 CCAGGTACTCTGCAAGAGGCGGG + Intronic
1099140533 12:78968847-78968869 CCAGATACTATCCAAGATGCTGG + Intronic
1100201822 12:92306793-92306815 CCAGGTCCTTTCCAAGACGTGGG - Intergenic
1101019520 12:100539390-100539412 CCAGGCACTGTCCAAGGTGCTGG + Intronic
1101328392 12:103737072-103737094 CCGGGCACTTTGCTAGGTGCTGG + Intronic
1101450076 12:104768057-104768079 CCAGGTAATTTCCATGTTGCTGG - Intergenic
1102627679 12:114248720-114248742 TCGGGCACTGTCCAAGGTGCTGG - Intergenic
1103217874 12:119217208-119217230 CCAGGCACTTTGCAAGTTGCTGG + Intronic
1104663367 12:130628441-130628463 GCGGGTCATTTCCAAGCTGCGGG + Intronic
1107101373 13:36597255-36597277 CTGGGTACTTTACAAGAAGTAGG + Intergenic
1110716363 13:78709600-78709622 CCAGATACTTTCCAGGATCCAGG + Intergenic
1113026116 13:105943121-105943143 CCGGGTAATTTACAAGAGACTGG - Intergenic
1117295027 14:54371252-54371274 CCAGGTACTATTCAAGGTGCTGG - Intergenic
1118417770 14:65561683-65561705 CCGAGAACTGTCCAAGATTCTGG + Exonic
1118796884 14:69152407-69152429 CCGCGTACTTTAAAAGGTGCTGG - Intronic
1120723209 14:87909750-87909772 TCTGGTATTGTCCAAGATGCGGG - Intronic
1122235662 14:100329531-100329553 CCGGGTCCTTTTCAAGGGGCTGG + Exonic
1122425160 14:101601530-101601552 CCTGGTACTTTCCACATTGCTGG + Intergenic
1126341015 15:47641277-47641299 CCAGCTACTGTTCAAGATGCAGG + Intronic
1127957095 15:63863048-63863070 CCAGCTCCTTGCCAAGATGCTGG - Intergenic
1129412244 15:75356431-75356453 CCAGGCTCTTTCCAGGATGCTGG - Exonic
1130123726 15:81074540-81074562 CCTGGAACTGTCCAGGATGCGGG + Intronic
1130788116 15:87122850-87122872 CTGGGCACTGTCCTAGATGCTGG - Intergenic
1134507687 16:14821417-14821439 CCGAGTGTTTTCCAAAATGCAGG + Intronic
1134695387 16:16220179-16220201 CCGAGTGTTTTCCAAAATGCAGG + Intronic
1135180748 16:20272138-20272160 CCAGGTACTGTCCAAGGTGCTGG + Intergenic
1136338605 16:29627632-29627654 CCTGGCCCTTTCCAAGGTGCGGG + Intergenic
1139305357 16:65981157-65981179 CTAGGTACTTTGCTAGATGCTGG - Intergenic
1144837748 17:18166031-18166053 CAGGGCACTTTCCCAGATCCAGG + Intronic
1147621280 17:41869281-41869303 TTGGGTACTTTGCTAGATGCTGG - Intronic
1149623680 17:58064670-58064692 CCGGGTTCTTTCCAATATTTAGG + Intergenic
1150159286 17:62881472-62881494 ACTGGAACTTTCCAAGATGATGG + Intergenic
1151175255 17:72282893-72282915 CCAGGTACTGTACAAGAGGCTGG - Intergenic
1152673492 17:81623877-81623899 CAGGGCACTTTGCTAGATGCTGG + Intronic
1153344300 18:4009494-4009516 CCTGGTACTCTCCTAGATACTGG + Intronic
1153711952 18:7809184-7809206 CCTGGTGTTTTCCAGGATGCCGG + Intronic
1153760730 18:8329532-8329554 CCATGTACTTTCCAAAGTGCTGG + Intronic
1157936732 18:51881843-51881865 CCAAATACTTTCCAAGATCCTGG + Intergenic
1161017753 19:1991639-1991661 CTGGGTCCTTTCCAGGATGCCGG + Intronic
1167635465 19:50652309-50652331 CCTGGCACTTTGCTAGATGCTGG + Intronic
925772043 2:7291844-7291866 CAGGGTACTATCCCAGATCCGGG - Intergenic
926341641 2:11909181-11909203 CCGGGTACCTTCCAGGATAGGGG + Intergenic
931492599 2:62765472-62765494 CCAGGTACTTTTCTAGATCCTGG + Intronic
932533586 2:72565940-72565962 CAGGGTAGTTTCCCAGAAGCAGG - Intronic
940768991 2:157820331-157820353 ACTGGTATTTTCCAAGATGCTGG + Intronic
941001120 2:160204814-160204836 CTGGGGACTTTACAGGATGCTGG - Intronic
941548207 2:166880568-166880590 CCTTGAACTTTCCAAGATTCTGG - Intergenic
943388426 2:187231145-187231167 CTGGGGAGCTTCCAAGATGCTGG - Intergenic
943401768 2:187421389-187421411 CCTTGAACTTTCCAGGATGCTGG - Intronic
1168849342 20:965866-965888 CCAGGCACTTTCCTAGGTGCTGG - Intronic
1168994914 20:2125877-2125899 CTGGGTGCTTTCCCAGCTGCCGG - Intronic
1172054653 20:32145703-32145725 CCAGGCACTTTGCCAGATGCTGG + Intronic
1173596230 20:44260031-44260053 CAGGGTAATCTCCAAGATGTGGG - Intronic
1173822734 20:46029559-46029581 CCGGGCGCTGTCCAAGGTGCTGG + Intronic
1174578814 20:51556519-51556541 CCGGGTACTTTCCAAGATGCTGG - Intronic
1176264189 20:64200142-64200164 CCGTGTCCTTGCCATGATGCTGG - Intronic
1179722373 21:43323002-43323024 CCAGGCACTGTCCAAGGTGCTGG - Intergenic
1182037012 22:27206847-27206869 CCAGGTGTTTTCCAAGAGGCTGG - Intergenic
1182040952 22:27238701-27238723 CCGTGTACTTCCCCAGAAGCGGG + Intergenic
1183228002 22:36563453-36563475 CCGGTGGCTTACCAAGATGCCGG - Intergenic
951309664 3:21109098-21109120 CTGGGTGCTTTCCAGGATGCGGG - Intergenic
952178215 3:30890309-30890331 CCAGGCACTTTGCTAGATGCTGG + Intronic
953403218 3:42645000-42645022 CCAGGCATTTTGCAAGATGCTGG - Intronic
953747638 3:45587222-45587244 CCGGGCCCTTTCCTAGGTGCTGG - Intronic
957327254 3:78712060-78712082 CAGGGTTCTTTTTAAGATGCTGG + Intronic
960993644 3:123327472-123327494 CGGGGTCCTTTTTAAGATGCAGG + Intronic
961525735 3:127496286-127496308 ACGGGTACTTTTGAAGCTGCAGG - Intergenic
963564538 3:146911830-146911852 CCAGGTACTTTGCTAGGTGCAGG - Intergenic
964442351 3:156725352-156725374 CAGGGTACTGTTCAAAATGCTGG - Intergenic
964680955 3:159338084-159338106 CCAGGAACTTTTCTAGATGCTGG + Intronic
964963071 3:162452585-162452607 CCAGGTACCTGCCTAGATGCCGG + Intergenic
965346618 3:167558780-167558802 CCAGTTACTTTCCAAGATAGAGG + Intronic
967463885 3:189779865-189779887 CTGCATACTTTCCAAGCTGCAGG + Intronic
978466846 4:109017185-109017207 CCAGGTACTGTCACAGATGCCGG - Intronic
979286319 4:118929039-118929061 CCAGGTACTTTCCTAAATGCTGG - Intronic
988099633 5:26660076-26660098 GCGGGTGGTTTCCAAGATGGCGG + Intergenic
990350599 5:54911766-54911788 CCGGGTACTTTCCTAGGAGCTGG - Intergenic
992159179 5:73983980-73984002 CAGGTTACTTTCCAATATCCAGG - Intergenic
992893171 5:81222665-81222687 CCAGGCACTGTGCAAGATGCTGG - Intronic
993140888 5:84031868-84031890 CAGTGTAATTTCCAATATGCTGG + Intronic
998378223 5:141705500-141705522 CCAGGCACTGTTCAAGATGCTGG - Intergenic
1002449475 5:179310685-179310707 CTGGGAACTTGCCAAAATGCAGG - Intronic
1013061616 6:106639478-106639500 CCGAGTATTTTCCAAGAGCCAGG - Intronic
1025191337 7:56898076-56898098 CCGAGTTCTATCCAAGGTGCAGG - Intergenic
1025680611 7:63678858-63678880 CCGAGTTCTATCCAAGGTGCAGG + Intergenic
1029130036 7:98322807-98322829 CAGGGATCTTTCCAAAATGCAGG + Intronic
1029931520 7:104376233-104376255 CCAGGTTCTGTCCTAGATGCTGG + Intronic
1035730818 8:1852534-1852556 CCGGGTTCTCTCCAGGATGATGG - Intronic
1039587889 8:38721827-38721849 CCCGGTACATTTCAAGGTGCAGG - Intergenic
1039587947 8:38722292-38722314 CCAGGTACATTGCAAGGTGCAGG - Intergenic
1041216763 8:55608483-55608505 CCAGGCACTTTACAAGATACTGG - Intergenic
1044466217 8:92509572-92509594 CCGTTTAGTTTCCAGGATGCTGG - Intergenic
1045030466 8:98130361-98130383 CCGGGTCCTTTGCCAGATGCTGG + Intronic
1047178903 8:122568450-122568472 CCGGGTTGTTTCCATGCTGCTGG - Intergenic
1049067167 8:140326074-140326096 CCGGGTAGTTTCTAAGAAGTCGG + Intronic
1053535302 9:38919804-38919826 CCTGGAACTTTCCAGGAAGCTGG - Intergenic
1054207522 9:62144208-62144230 CCTGGAACTTTCCAGGAAGCTGG - Intergenic
1054630829 9:67444146-67444168 CCTGGAACTTTCCAGGAAGCTGG + Intergenic
1055573680 9:77642072-77642094 CAGGGAACTTTCCAGGATGATGG + Intronic
1058113235 9:101054660-101054682 CCAGGGCCTTTCCAAGGTGCTGG + Intronic
1060035541 9:120252429-120252451 CCAGGCACTCTCCAAGGTGCTGG + Intergenic
1060560511 9:124538732-124538754 CCGGGTTCCTTGCTAGATGCTGG - Intronic
1186030650 X:5365766-5365788 CTATGTCCTTTCCAAGATGCTGG + Intergenic
1186789419 X:12982561-12982583 CCTGGCTCTTTCCAAGTTGCTGG + Intergenic
1194123437 X:89987444-89987466 CCTGGAACTTGCCAAGCTGCAGG - Intergenic
1196072481 X:111541868-111541890 AAGGGAACTTTCCAGGATGCAGG - Intergenic
1196307391 X:114120286-114120308 CCAGTTTCTTTCCAAGATTCTGG - Intergenic
1198658753 X:138943355-138943377 CCGTGTACTGTCCTACATGCAGG - Intronic
1200476321 Y:3645061-3645083 CCTGGAACTTGCCAAGCTGCAGG - Intergenic