ID: 1174579689

View in Genome Browser
Species Human (GRCh38)
Location 20:51562780-51562802
Sequence GGCTCCCGGCTCGGCGGAGT CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 106
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 94}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1174579675_1174579689 22 Left 1174579675 20:51562735-51562757 CCTGGCCGAGGAGCCTCGGAGCG 0: 1
1: 0
2: 0
3: 14
4: 169
Right 1174579689 20:51562780-51562802 GGCTCCCGGCTCGGCGGAGTCGG 0: 1
1: 0
2: 0
3: 11
4: 94
1174579676_1174579689 17 Left 1174579676 20:51562740-51562762 CCGAGGAGCCTCGGAGCGACCCG 0: 1
1: 0
2: 0
3: 7
4: 87
Right 1174579689 20:51562780-51562802 GGCTCCCGGCTCGGCGGAGTCGG 0: 1
1: 0
2: 0
3: 11
4: 94
1174579682_1174579689 -3 Left 1174579682 20:51562760-51562782 CCGGGAGCTGCGCGCCTCCCGGC 0: 1
1: 0
2: 1
3: 26
4: 242
Right 1174579689 20:51562780-51562802 GGCTCCCGGCTCGGCGGAGTCGG 0: 1
1: 0
2: 0
3: 11
4: 94
1174579680_1174579689 -2 Left 1174579680 20:51562759-51562781 CCCGGGAGCTGCGCGCCTCCCGG 0: 1
1: 0
2: 1
3: 20
4: 204
Right 1174579689 20:51562780-51562802 GGCTCCCGGCTCGGCGGAGTCGG 0: 1
1: 0
2: 0
3: 11
4: 94
1174579674_1174579689 23 Left 1174579674 20:51562734-51562756 CCCTGGCCGAGGAGCCTCGGAGC 0: 1
1: 0
2: 1
3: 8
4: 183
Right 1174579689 20:51562780-51562802 GGCTCCCGGCTCGGCGGAGTCGG 0: 1
1: 0
2: 0
3: 11
4: 94
1174579679_1174579689 9 Left 1174579679 20:51562748-51562770 CCTCGGAGCGACCCGGGAGCTGC 0: 1
1: 0
2: 0
3: 8
4: 89
Right 1174579689 20:51562780-51562802 GGCTCCCGGCTCGGCGGAGTCGG 0: 1
1: 0
2: 0
3: 11
4: 94

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1174579689 Original CRISPR GGCTCCCGGCTCGGCGGAGT CGG Intronic
900237537 1:1599927-1599949 GGCTCCCAGCCCGGCGGCGTCGG + Exonic
900510042 1:3054524-3054546 GGCTCCCGGCGGGGCTGTGTGGG - Intergenic
900820125 1:4880042-4880064 GGCCCCCGGCTGGCAGGAGTAGG - Intergenic
901934555 1:12618531-12618553 GGCAGCCGGCTCGCCGGAGTCGG - Intergenic
904682926 1:32241343-32241365 AGCGCGCGGCTTGGCGGAGTAGG - Intergenic
905379843 1:37554051-37554073 GGCTCGCTGGTCGGCGGAGACGG + Exonic
907767385 1:57424209-57424231 GGCTCACGGCCCGGCGGCGGCGG - Intronic
908272945 1:62437626-62437648 GGCGCCCGGCGCGGGGGTGTGGG + Intronic
922214129 1:223506961-223506983 GGCTCCAGGCTCAGCGGTGGTGG + Intergenic
924289720 1:242524710-242524732 GGCTCCCGGGGCGGCGGCGGCGG + Intergenic
1063392836 10:5661326-5661348 GGCCCCAGGCTCGGCGGGGCGGG - Intronic
1068910445 10:62374131-62374153 GGCTCCCGGCTGGGTGGCGGGGG + Intergenic
1069615061 10:69801721-69801743 GGCTCCCGGGCCGGCGGGCTGGG + Intergenic
1070768481 10:79069470-79069492 AGCTCCCGGCTGCGCGGAGCCGG + Intronic
1071695290 10:87863512-87863534 GGCTCCCGGCGCGGCGGCGGAGG + Exonic
1077432417 11:2522375-2522397 GTTTCCCGGCTCTGCAGAGTGGG + Intronic
1080230916 11:30017091-30017113 GCCTCCCGGCGCGGCGGGGCGGG + Intergenic
1081699973 11:45146804-45146826 GGCGGGCGGCTCGGCGGAGGCGG - Intronic
1083860460 11:65417580-65417602 GGCTCCCTGCTCAGAGGAGCTGG + Intergenic
1084019462 11:66409202-66409224 GGCTCGCGGCTCGGGGGCGGGGG - Intergenic
1085280401 11:75326182-75326204 GGCTCCAGGCTGGGAGGAGGAGG + Intronic
1088880846 11:113972199-113972221 GGCTCTCGGCAAGGCGGAGTGGG - Intergenic
1089533833 11:119149165-119149187 GGCCCTCGGCTCGGAGGAGACGG - Exonic
1091550370 12:1531198-1531220 GGCTCCGGGGTCGGCGGCGCAGG + Intronic
1091582274 12:1797117-1797139 GGCTGCGGCCTCGGCGGGGTGGG + Intronic
1096214919 12:49793420-49793442 GGCTCGCTGCTCGGCTGTGTGGG + Exonic
1105437916 13:20392329-20392351 GGCGTCCGGGGCGGCGGAGTGGG - Intergenic
1108373342 13:49792280-49792302 GGCCCCGGGCTGGGCGGAGCGGG - Intronic
1108688981 13:52846015-52846037 GGCTCCCGGCTCCCCGGAGGAGG - Exonic
1113857004 13:113452264-113452286 GGCTCCCGGCTTGCTGGAGACGG - Intronic
1117119431 14:52552494-52552516 CGCCACCGACTCGGCGGAGTCGG + Exonic
1117875960 14:60249827-60249849 GCCGCCCGGCTCGGGGGAGGAGG - Intronic
1120765427 14:88323523-88323545 GGCACCCGGCTCGGGGCAGCGGG + Intronic
1122807498 14:104267466-104267488 GGCTACCGTCTCGGGGAAGTGGG - Intergenic
1130303760 15:82699486-82699508 GGGTCCAGGCTGGGCGGAGAAGG - Intronic
1131117869 15:89805592-89805614 GGCTCCCGGCGAGGCGGGGGTGG - Intronic
1132055763 15:98649330-98649352 GGCCCAGGGCTCGGCGGAGTCGG - Exonic
1132719770 16:1309868-1309890 GGGGCCCGGCTCGGCGGGGCGGG - Intronic
1132729648 16:1355118-1355140 GTCTCCCGCCTCTGCGGGGTCGG + Intronic
1132889425 16:2196594-2196616 GGCTCCCGGCGCGGAGGGGGCGG + Intergenic
1136118183 16:28108975-28108997 GGCTCCCTGCTCAGCAGTGTGGG - Intronic
1138686833 16:58733717-58733739 GGCCCCCGGCCCGCCCGAGTCGG - Intronic
1139734141 16:68972915-68972937 TGATCCTGGCTCGGAGGAGTCGG - Intronic
1141461431 16:84180641-84180663 GGCTCCCGGGTCAGGAGAGTGGG - Intronic
1142483751 17:233959-233981 CGCTCCCTGCTCGGGGAAGTTGG - Intronic
1142483760 17:233996-234018 CGCTCCCTGCTCGGGGAAGTTGG - Intronic
1142483769 17:234033-234055 CGCTCCCTGCTCGGGGAAGTTGG - Intronic
1142483778 17:234070-234092 CGCTCCCTGCTCGGGGAAGTTGG - Intronic
1142483838 17:234331-234353 CGCTCCCTGCTCGGGGAAGTTGG - Intronic
1142483847 17:234368-234390 CGCTCCCTGCTCGGGGAAGTTGG - Intronic
1142631485 17:1229168-1229190 GGCTCCCGGCACGGACGAGGGGG - Intergenic
1143719286 17:8798855-8798877 GGCTCCCTGCTCGGCTCGGTGGG - Exonic
1144775370 17:17782405-17782427 GGCACCCCGCCCGGCGGAGGAGG - Intronic
1147440145 17:40443053-40443075 GACTCCCGGCTCTGCGGATCCGG - Intergenic
1148240417 17:45996488-45996510 GGCTCCCGGGTGGGTGGGGTTGG - Exonic
1152548930 17:81019667-81019689 AGCTCCCGCCTCCCCGGAGTGGG - Intergenic
1152648472 17:81481283-81481305 GGTTCCCGGCTCGGAGGCGCTGG - Intergenic
1153515187 18:5895534-5895556 CCCGCCCGGCTCGGCGGAGTCGG + Intronic
1154160974 18:11981010-11981032 GGCTCGAGGCTCAGAGGAGTTGG + Intronic
1155652525 18:28159202-28159224 GACTCCCAGATGGGCGGAGTAGG - Intronic
1157260894 18:46174584-46174606 TCCTCCCGGCCCGGCGGAGTTGG + Intronic
1158689785 18:59650025-59650047 GGCTCCCAGCTGGGTGGAGATGG - Intronic
1160769184 19:822539-822561 GGACCCCGGCGCGGCGGAGGGGG - Intergenic
1162501766 19:11058203-11058225 GGCTCCCGGGTGGGCGGACTCGG + Intronic
1163630934 19:18417659-18417681 GGGCCCCGGCTCGGCGGGGTAGG - Intergenic
1167333951 19:48873314-48873336 GGCTCCAGGCGCGGCTGAGGAGG - Exonic
926212443 2:10880698-10880720 GGCTCCCGGTGCGAAGGAGTGGG + Intergenic
927190272 2:20512436-20512458 AGCTCCCGCCATGGCGGAGTTGG - Intergenic
935246538 2:101223761-101223783 GTCTCCCTGCTCTGGGGAGTGGG + Intronic
937439859 2:121906375-121906397 GGCTCGAGGCTCGGAGGAGCTGG + Intergenic
943662133 2:190570536-190570558 GGCTCCCAGCTCCGAGGAGGAGG - Intergenic
947624915 2:231613328-231613350 GGCTCCCGGCTCTGCCCAGATGG - Intergenic
948464244 2:238144680-238144702 AGTTCCAGGCTCTGCGGAGTGGG + Intronic
1169105847 20:2993857-2993879 TGCTCCCGGCTCTGTGAAGTTGG - Intronic
1171011375 20:21510968-21510990 GGCCTCCGGCCCGGCGCAGTAGG + Intergenic
1174579689 20:51562780-51562802 GGCTCCCGGCTCGGCGGAGTCGG + Intronic
1175036536 20:56005444-56005466 GGCTCCCGGCCAGGCGCGGTCGG - Exonic
1175960093 20:62631524-62631546 GGCAGCCGGCTCGGTGGGGTGGG + Intergenic
1180228333 21:46411730-46411752 GGCCTCCAGCTCGGCAGAGTGGG - Exonic
952942433 3:38454532-38454554 GGCGCCCGGCTCGCCGAACTTGG + Intronic
960955447 3:123027678-123027700 CCCGCCCGGCTCGGCGGAGCTGG + Intronic
967118394 3:186361916-186361938 GGCGGCCGGCGCGGCGGAGGGGG - Intronic
969496212 4:7527726-7527748 GGCCCCAGGCTCAGCGGAGGGGG - Intronic
996403476 5:123086634-123086656 GGGGCCCCGCTCGGCGCAGTGGG + Intergenic
1006727983 6:36213894-36213916 GGCTCCAGGGTTGGCGGAGGAGG - Exonic
1010214389 6:73388899-73388921 GGCTCCTTGCCTGGCGGAGTCGG + Intronic
1017672364 6:156779108-156779130 GGCCGCCGGCTCGGCGGCGGGGG + Exonic
1019492365 7:1321418-1321440 GGCTCCCCCCAGGGCGGAGTGGG - Intergenic
1026036447 7:66833316-66833338 GGCTCCTGGCTTGGCACAGTAGG + Intergenic
1026037518 7:66840229-66840251 GGCTCCTGGCTTGGCACAGTAGG + Intergenic
1026923710 7:74174473-74174495 GGCTGCGGGACCGGCGGAGTCGG + Intronic
1035034214 7:155884743-155884765 GGCTCCCGGCTCCGGGGAACCGG - Intergenic
1039430105 8:37519361-37519383 GGCTCCCGGCTCTGTGGACAGGG + Intergenic
1039454583 8:37698349-37698371 GGCTCCCGGCAGGGCCGTGTGGG - Exonic
1039921302 8:41896238-41896260 GGCGCCCGGTGCGGCGGAGTTGG - Intronic
1044698914 8:94949193-94949215 GGCCGCCGGCTCGGCGGGGAAGG + Exonic
1045300869 8:100908686-100908708 GGCTCCAGGCTCCACGGAGCTGG - Intergenic
1048223851 8:132566422-132566444 GGCTTCCTGCTCTGCGGGGTTGG + Intergenic
1050345238 9:4679670-4679692 GGCTTCTGGCTCGGCGCAGCAGG + Exonic
1052633669 9:31072063-31072085 GGCTTCCTGCTCCGCGGAGCAGG - Intergenic
1052855354 9:33403210-33403232 GGCTCGGGGCTCAGCGGTGTGGG + Intergenic
1057306008 9:93912382-93912404 GGCTCCAGGCTTGGCGGGCTTGG - Intergenic
1059633969 9:116154440-116154462 AGCGCCCGGCTCGGCGGGCTCGG - Exonic
1060814116 9:126625893-126625915 GGCGCTCGCCTCGGCGCAGTGGG + Intronic
1062472432 9:136712409-136712431 GACCCCCGGCTCGGCTGAGGAGG - Intergenic
1192503527 X:71667874-71667896 GGCTCCCGGGCTGGCGGTGTGGG - Intergenic