ID: 1174580887

View in Genome Browser
Species Human (GRCh38)
Location 20:51570754-51570776
Sequence ATTCTGTCTTGGGGGACCCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1174580887_1174580896 3 Left 1174580887 20:51570754-51570776 CCCAGGGTCCCCCAAGACAGAAT No data
Right 1174580896 20:51570780-51570802 ACCCAACAGGGAGGTTTCTGAGG No data
1174580887_1174580895 -6 Left 1174580887 20:51570754-51570776 CCCAGGGTCCCCCAAGACAGAAT No data
Right 1174580895 20:51570771-51570793 CAGAATGTAACCCAACAGGGAGG No data
1174580887_1174580899 10 Left 1174580887 20:51570754-51570776 CCCAGGGTCCCCCAAGACAGAAT No data
Right 1174580899 20:51570787-51570809 AGGGAGGTTTCTGAGGCATTTGG No data
1174580887_1174580894 -9 Left 1174580887 20:51570754-51570776 CCCAGGGTCCCCCAAGACAGAAT No data
Right 1174580894 20:51570768-51570790 AGACAGAATGTAACCCAACAGGG No data
1174580887_1174580893 -10 Left 1174580887 20:51570754-51570776 CCCAGGGTCCCCCAAGACAGAAT No data
Right 1174580893 20:51570767-51570789 AAGACAGAATGTAACCCAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1174580887 Original CRISPR ATTCTGTCTTGGGGGACCCT GGG (reversed) Intergenic
No off target data available for this crispr