ID: 1174581720

View in Genome Browser
Species Human (GRCh38)
Location 20:51576940-51576962
Sequence CAGAAGAAGGGGAAGGGGTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1174581720_1174581730 6 Left 1174581720 20:51576940-51576962 CCCCACCCCTTCCCCTTCTTCTG No data
Right 1174581730 20:51576969-51576991 GTGCCCCAATTTTTACTTTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1174581720 Original CRISPR CAGAAGAAGGGGAAGGGGTG GGG (reversed) Intergenic
No off target data available for this crispr