ID: 1174582522

View in Genome Browser
Species Human (GRCh38)
Location 20:51582172-51582194
Sequence CTGGATTAGGAATAAGGATG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1174582522_1174582532 24 Left 1174582522 20:51582172-51582194 CCCCATCCTTATTCCTAATCCAG No data
Right 1174582532 20:51582219-51582241 GTGATCAGCTGACTAAGGGCAGG No data
1174582522_1174582531 20 Left 1174582522 20:51582172-51582194 CCCCATCCTTATTCCTAATCCAG No data
Right 1174582531 20:51582215-51582237 GTTAGTGATCAGCTGACTAAGGG No data
1174582522_1174582530 19 Left 1174582522 20:51582172-51582194 CCCCATCCTTATTCCTAATCCAG No data
Right 1174582530 20:51582214-51582236 AGTTAGTGATCAGCTGACTAAGG No data
1174582522_1174582528 -9 Left 1174582522 20:51582172-51582194 CCCCATCCTTATTCCTAATCCAG No data
Right 1174582528 20:51582186-51582208 CTAATCCAGAGCACATCAGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1174582522 Original CRISPR CTGGATTAGGAATAAGGATG GGG (reversed) Intergenic
No off target data available for this crispr