ID: 1174582525

View in Genome Browser
Species Human (GRCh38)
Location 20:51582178-51582200
Sequence TGTGCTCTGGATTAGGAATA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1174582525_1174582532 18 Left 1174582525 20:51582178-51582200 CCTTATTCCTAATCCAGAGCACA No data
Right 1174582532 20:51582219-51582241 GTGATCAGCTGACTAAGGGCAGG No data
1174582525_1174582531 14 Left 1174582525 20:51582178-51582200 CCTTATTCCTAATCCAGAGCACA No data
Right 1174582531 20:51582215-51582237 GTTAGTGATCAGCTGACTAAGGG No data
1174582525_1174582530 13 Left 1174582525 20:51582178-51582200 CCTTATTCCTAATCCAGAGCACA No data
Right 1174582530 20:51582214-51582236 AGTTAGTGATCAGCTGACTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1174582525 Original CRISPR TGTGCTCTGGATTAGGAATA AGG (reversed) Intergenic
No off target data available for this crispr