ID: 1174582528

View in Genome Browser
Species Human (GRCh38)
Location 20:51582186-51582208
Sequence CTAATCCAGAGCACATCAGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1174582520_1174582528 15 Left 1174582520 20:51582148-51582170 CCGATACAAGGTCCAAGTCTTTA No data
Right 1174582528 20:51582186-51582208 CTAATCCAGAGCACATCAGGTGG No data
1174582518_1174582528 28 Left 1174582518 20:51582135-51582157 CCATGAGTCTCAACCGATACAAG No data
Right 1174582528 20:51582186-51582208 CTAATCCAGAGCACATCAGGTGG No data
1174582521_1174582528 3 Left 1174582521 20:51582160-51582182 CCAAGTCTTTATCCCCATCCTTA No data
Right 1174582528 20:51582186-51582208 CTAATCCAGAGCACATCAGGTGG No data
1174582522_1174582528 -9 Left 1174582522 20:51582172-51582194 CCCCATCCTTATTCCTAATCCAG No data
Right 1174582528 20:51582186-51582208 CTAATCCAGAGCACATCAGGTGG No data
1174582523_1174582528 -10 Left 1174582523 20:51582173-51582195 CCCATCCTTATTCCTAATCCAGA No data
Right 1174582528 20:51582186-51582208 CTAATCCAGAGCACATCAGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1174582528 Original CRISPR CTAATCCAGAGCACATCAGG TGG Intergenic
No off target data available for this crispr