ID: 1174582529 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 20:51582191-51582213 |
| Sequence | AAAGACCACCTGATGTGCTC TGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 3 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1174582529_1174582532 | 5 | Left | 1174582529 | 20:51582191-51582213 | CCAGAGCACATCAGGTGGTCTTT | No data | ||
| Right | 1174582532 | 20:51582219-51582241 | GTGATCAGCTGACTAAGGGCAGG | No data | ||||
| 1174582529_1174582531 | 1 | Left | 1174582529 | 20:51582191-51582213 | CCAGAGCACATCAGGTGGTCTTT | No data | ||
| Right | 1174582531 | 20:51582215-51582237 | GTTAGTGATCAGCTGACTAAGGG | No data | ||||
| 1174582529_1174582530 | 0 | Left | 1174582529 | 20:51582191-51582213 | CCAGAGCACATCAGGTGGTCTTT | No data | ||
| Right | 1174582530 | 20:51582214-51582236 | AGTTAGTGATCAGCTGACTAAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1174582529 | Original CRISPR | AAAGACCACCTGATGTGCTC TGG (reversed) | Intergenic | ||