ID: 1174582531

View in Genome Browser
Species Human (GRCh38)
Location 20:51582215-51582237
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1174582524_1174582531 18 Left 1174582524 20:51582174-51582196 CCATCCTTATTCCTAATCCAGAG No data
Right 1174582531 20:51582215-51582237 GTTAGTGATCAGCTGACTAAGGG No data
1174582525_1174582531 14 Left 1174582525 20:51582178-51582200 CCTTATTCCTAATCCAGAGCACA No data
Right 1174582531 20:51582215-51582237 GTTAGTGATCAGCTGACTAAGGG No data
1174582527_1174582531 7 Left 1174582527 20:51582185-51582207 CCTAATCCAGAGCACATCAGGTG No data
Right 1174582531 20:51582215-51582237 GTTAGTGATCAGCTGACTAAGGG No data
1174582523_1174582531 19 Left 1174582523 20:51582173-51582195 CCCATCCTTATTCCTAATCCAGA No data
Right 1174582531 20:51582215-51582237 GTTAGTGATCAGCTGACTAAGGG No data
1174582529_1174582531 1 Left 1174582529 20:51582191-51582213 CCAGAGCACATCAGGTGGTCTTT No data
Right 1174582531 20:51582215-51582237 GTTAGTGATCAGCTGACTAAGGG No data
1174582522_1174582531 20 Left 1174582522 20:51582172-51582194 CCCCATCCTTATTCCTAATCCAG No data
Right 1174582531 20:51582215-51582237 GTTAGTGATCAGCTGACTAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1174582531 Original CRISPR GTTAGTGATCAGCTGACTAA GGG Intergenic