ID: 1174584699

View in Genome Browser
Species Human (GRCh38)
Location 20:51599093-51599115
Sequence CAGCAGAAGCAGAATGAAGA TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 1184
Summary {0: 1, 1: 0, 2: 9, 3: 126, 4: 1048}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1174584699_1174584703 26 Left 1174584699 20:51599093-51599115 CCATCTTCATTCTGCTTCTGCTG 0: 1
1: 0
2: 9
3: 126
4: 1048
Right 1174584703 20:51599142-51599164 CTCCCACACGCCCTGCCTGCAGG 0: 1
1: 0
2: 1
3: 36
4: 321
1174584699_1174584701 3 Left 1174584699 20:51599093-51599115 CCATCTTCATTCTGCTTCTGCTG 0: 1
1: 0
2: 9
3: 126
4: 1048
Right 1174584701 20:51599119-51599141 ACCTCTAAAACTTTCTGACGAGG 0: 1
1: 0
2: 0
3: 7
4: 61

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1174584699 Original CRISPR CAGCAGAAGCAGAATGAAGA TGG (reversed) Exonic
900762982 1:4485407-4485429 GAGAAGAACCAGACTGAAGAAGG + Intergenic
900861040 1:5231581-5231603 CATAGGAAGCAGAAGGAAGAGGG + Intergenic
901185289 1:7368958-7368980 AAACAGAAGCAGAAGGAGGAAGG - Intronic
902515257 1:16986505-16986527 CAGCAGCAGCAGCTTGAAGCCGG + Exonic
902792648 1:18779419-18779441 CAGCAGAAGCAAAACCAAGGTGG + Intergenic
902805313 1:18857660-18857682 AAGCAGATCCAGAATGAGGAAGG + Intronic
902999281 1:20253272-20253294 TGGCAGAAGCAGAGTAAAGAGGG + Intergenic
903049600 1:20590816-20590838 TTGGAGAAGCAGAAGGAAGAGGG + Intronic
903332002 1:22601223-22601245 CAGAAGAAGCAGGCTGAGGAAGG - Intronic
903458033 1:23502095-23502117 GAGAAGAAGAAGAAAGAAGAAGG - Intergenic
904222861 1:28987480-28987502 CAGCACCAACAGAAGGAAGAGGG + Exonic
904295393 1:29516937-29516959 GAGGAGAAGGAGAAGGAAGAAGG - Intergenic
904295740 1:29518748-29518770 GAGGAGAAGGAGAAGGAAGAAGG - Intergenic
904295752 1:29518808-29518830 GAGGAGAAGGAGAAGGAAGAAGG - Intergenic
904295762 1:29518859-29518881 AAGGAGAAGGAGAATGAGGAAGG - Intergenic
904295769 1:29518898-29518920 AAGAAGAAGGAGAAGGAAGAAGG - Intergenic
905409563 1:37759072-37759094 CAGAAGATGAAGAAGGAAGATGG - Intronic
905461952 1:38127870-38127892 CAGTCAAAGCAGAGTGAAGAAGG - Intergenic
906180817 1:43817339-43817361 AAGAAGAAGAAGAAGGAAGAAGG - Intronic
906180828 1:43817431-43817453 AAGAAGAAGGAGAAGGAAGAAGG - Intronic
906180840 1:43817557-43817579 AAGGAGAAGAAGAAGGAAGAAGG - Intronic
906180868 1:43817697-43817719 GAGGAGAAGGAGAAGGAAGAAGG - Intronic
906267851 1:44447835-44447857 CAGCACAGGCAGCATGAAGCAGG - Intronic
906352468 1:45074864-45074886 CAGCAAAAGCAGTACTAAGAGGG - Intronic
906495157 1:46300592-46300614 CACCAAGAGCAGGATGAAGAGGG - Intronic
906581835 1:46941344-46941366 CAGCAGAAGCAGAATGAGCAGGG + Exonic
906601882 1:47137553-47137575 CAGCAGAAGCAGAATGAGCAGGG - Exonic
906985015 1:50673913-50673935 TAGCAGAAGCAGAATTCAAAAGG + Intronic
907393671 1:54175020-54175042 CAGCAGAGGCACAGGGAAGAGGG + Intronic
907530272 1:55088656-55088678 CAGCTGAGGCAGAGTGAAGGAGG + Intronic
908427207 1:64018645-64018667 CAGGAAAAGCAGTATGGAGAGGG + Intronic
908605123 1:65790448-65790470 GAGCAGAAGCAGAAGGAAGAAGG - Intergenic
908820672 1:68083074-68083096 CAGGAGAGGGAGAATGAAAAAGG + Intergenic
908857875 1:68449936-68449958 CACCAACTGCAGAATGAAGAAGG + Exonic
908910647 1:69069151-69069173 CAGCAAAAGCAGCGTTAAGAAGG - Intergenic
908950620 1:69558444-69558466 CAGCTGAAGCAGTTTTAAGAGGG - Intergenic
908970182 1:69819208-69819230 CAGCAAAAGCAGTTTTAAGAGGG - Intronic
909082677 1:71132444-71132466 CAGCAAAAGCAGTTTTAAGAAGG + Intergenic
909104145 1:71387864-71387886 CAGCAGAAGCAGTATTCAAAGGG + Intergenic
909252649 1:73378847-73378869 AAGCAGAAACAGAATAAAAAGGG + Intergenic
909270445 1:73617327-73617349 CACCAGAAGCTGACTAAAGAGGG - Intergenic
909303357 1:74040779-74040801 CAGCTAAAGCAGTATTAAGAGGG + Intronic
909331582 1:74418940-74418962 CAGCAACAGCAGAAACAAGAAGG - Intronic
909377792 1:74960041-74960063 GAGCAGAAGCAAAAGAAAGAGGG - Intergenic
909385082 1:75045731-75045753 CAGCAAAAGCAGTACTAAGAGGG + Intergenic
909456370 1:75854316-75854338 CAGCATAGGCAGAGTGAAGATGG - Intronic
909498312 1:76304516-76304538 CAGGAGGAGCAGCATGAACAAGG + Intronic
909587509 1:77307246-77307268 CAGCAAAAGCAGTATTAAGAAGG - Intronic
909791068 1:79679391-79679413 CACAAGAAGAAGAATGGAGAAGG - Intergenic
909872793 1:80764359-80764381 CAGCAGGAGCAGAATAGAAAAGG - Intergenic
910158069 1:84242872-84242894 CACCAGACGCAGAATGGAAATGG + Intergenic
910165036 1:84318258-84318280 AAACAGAAGCAGTATTAAGAGGG - Intronic
910351312 1:86301346-86301368 CAGCAAAAGCAGTATTAACAGGG - Intergenic
911148751 1:94576919-94576941 CAGCTAAAGCAGCATTAAGAGGG - Intergenic
911411860 1:97519848-97519870 CAGCAGATGGAGAAGAAAGATGG - Intronic
911594944 1:99788831-99788853 GAGTAGAAACAGAATGAGGAGGG - Intergenic
911663246 1:100527150-100527172 AAGAAGAAGAAGAAAGAAGAAGG - Intergenic
911800428 1:102131265-102131287 CAGCTAAAGCAGTATTAAGAGGG + Intergenic
912136500 1:106665774-106665796 CAGCAAAAGCAGTACTAAGAGGG + Intergenic
912416710 1:109513593-109513615 CATCAGAATCAGAGTGGAGAAGG + Intergenic
912421138 1:109543156-109543178 CAGCAGGAGCATGAAGAAGAGGG - Exonic
912469686 1:109898021-109898043 CAGCAAAAGCAAAGTGGAGAGGG - Intergenic
912588587 1:110790217-110790239 CACCAAAAGCAGTATTAAGAGGG + Intergenic
912861444 1:113217404-113217426 CTGCAGAAGCAGAAGAAAGCTGG - Intergenic
912885425 1:113467091-113467113 CAACAAAAGCAGTATTAAGAGGG - Intronic
912898957 1:113627079-113627101 CAGCAAAAGCAGTACTAAGAGGG - Intronic
913397492 1:118388391-118388413 AAGCAGAAGCAGAATGACTCTGG + Intergenic
913473779 1:119217184-119217206 CTGGACAAGCAGAATGATGATGG - Intergenic
913691177 1:121281339-121281361 AAGAAGAAAGAGAATGAAGAAGG - Intronic
914146365 1:144998633-144998655 AAGAAGAAAGAGAATGAAGAAGG + Intronic
914492840 1:148162833-148162855 CTCCAGAAGCAGAATCAAGTGGG + Intergenic
914895945 1:151673114-151673136 CAGCAAAAGCAGTACTAAGAAGG - Intronic
915061075 1:153185865-153185887 CAGCTAAAGCAGCATAAAGAGGG - Intergenic
915076281 1:153310618-153310640 CTGGAGACCCAGAATGAAGAAGG + Exonic
915116230 1:153601910-153601932 CAGCAAAAGTAGTATAAAGAGGG + Intergenic
915515714 1:156411321-156411343 CAGCAGAAGCACAATGCGGAGGG + Intronic
915639533 1:157213244-157213266 CAGCTAAAGCAGAGTTAAGAGGG - Intergenic
915740712 1:158116459-158116481 GAGCAGAAGCCAAATGGAGAAGG + Intergenic
916468230 1:165093550-165093572 TAGCAGAGGCAGGATGAAGGGGG - Intergenic
916616102 1:166441928-166441950 CAGCAAAAGCAGTACTAAGAAGG - Intergenic
917284143 1:173407015-173407037 CAGCAGCAGCAGGATGAGAAGGG + Intergenic
917300308 1:173566829-173566851 CAGCAAAAGCAGTACTAAGAGGG - Intronic
917305543 1:173620442-173620464 CAGCTAAAGCAGAGTTAAGAGGG + Intronic
917335907 1:173924167-173924189 CAGGAGAAGCATAGTGGAGAGGG - Intergenic
917372849 1:174314648-174314670 CAGCAAAAGCAGTACAAAGAGGG - Intronic
918015349 1:180628328-180628350 CAACAGAGGGAGAAGGAAGAAGG - Intergenic
918225760 1:182480949-182480971 CAGCAAAAGCAGTACTAAGATGG + Intronic
918410498 1:184253626-184253648 CAGCAGAAGCTGAATCCACAAGG - Intergenic
918415811 1:184306879-184306901 CAGCAAAAGCAGTACTAAGATGG - Intergenic
918671341 1:187220845-187220867 CAGCAAAAGCAGTACTAAGAAGG - Intergenic
918713873 1:187765283-187765305 CAGAAAAAGCAGAATGAAAAAGG - Intergenic
919012993 1:191989187-191989209 CAGCAAAAGCAGTACTAAGAGGG + Intergenic
919269651 1:195323397-195323419 CAGCAAAAGCAGTACTAAGAGGG - Intergenic
919316572 1:195978550-195978572 CAGCAAAAGCAGTACTAAGAGGG - Intergenic
919321637 1:196048101-196048123 CAGTAGCAGGAGAAAGAAGAGGG + Intergenic
919594568 1:199546063-199546085 CAGCTGAAAAAGAAGGAAGAAGG + Intergenic
919756479 1:201069256-201069278 CAGCAGCAGCAGCATAAAGCAGG + Intronic
920478501 1:206299815-206299837 AAGAAGAAAGAGAATGAAGAAGG - Intronic
921042995 1:211452100-211452122 CAGCAAAAGCAGTACTAAGAGGG + Intergenic
921147355 1:212370782-212370804 CAGCAAAAGCAGTACTAAGAGGG + Intronic
921298184 1:213724025-213724047 GAGCAGAAGCAGGATGCAGTAGG + Intergenic
921351657 1:214242340-214242362 CAGCAAGAGCAGGAGGAAGAAGG - Intergenic
921910291 1:220541281-220541303 CAGCAAAAGCAGTACTAAGAGGG - Intronic
922253132 1:223868301-223868323 CAGCTAAAGCAGAATTTAGAGGG - Intergenic
922464375 1:225836743-225836765 CAGCAGAAGCAGAGAGGAGAAGG + Intronic
922983365 1:229847578-229847600 CAGGAGCAGCAGAATGACCAAGG + Intergenic
923378668 1:233392609-233392631 GAGAAGAAGAAGAAAGAAGAAGG - Intergenic
923714243 1:236411512-236411534 AAGAAGAAGAAGAAAGAAGAAGG - Intronic
923878910 1:238082280-238082302 CAGCAAAAGCAGTATTAAGAGGG - Intergenic
923893821 1:238246295-238246317 CAGCAAAAACAGTTTGAAGAGGG + Intergenic
924856477 1:247879648-247879670 CAGCTGGAGCAGAATGCAAAGGG - Intergenic
1063203577 10:3809375-3809397 CAGTAGAAGCACAATGTAAATGG + Intergenic
1063330682 10:5155929-5155951 GAGAAGAGGCAGAATGAAGGTGG - Intergenic
1063475571 10:6325895-6325917 CGGCAGAAGGAGCATGAGGAAGG - Intergenic
1063917197 10:10895459-10895481 AAGCAGAAGCAGAAAAAATATGG + Intergenic
1065765652 10:29026997-29027019 GAGGAGAAGGAGGATGAAGAAGG + Intergenic
1066693587 10:38057948-38057970 GAGCAGAACCAGAATCAAGCTGG + Exonic
1067150792 10:43731666-43731688 AAGCAGAAACAGAAGGAGGAAGG - Intergenic
1067205767 10:44211500-44211522 CAGGAGAAGCAGCATGAGGGGGG - Intergenic
1067786826 10:49256351-49256373 CAGCTAATGCAGAATGAACAAGG + Intergenic
1067949675 10:50720750-50720772 CAGGAGATGCTGAATAAAGATGG - Intergenic
1067972696 10:50991188-50991210 CAGCAGAAGCGGATCGAAGCAGG + Intergenic
1068117055 10:52747039-52747061 CAGCAGACTCAGAATGGAGTGGG - Intergenic
1068126538 10:52848407-52848429 CAGCAAAAGCAGTGTTAAGAAGG - Intergenic
1068563149 10:58540114-58540136 CAGCAAAAGCAGTAGTAAGAGGG + Intronic
1070161307 10:73868258-73868280 CAGAGGAAGCAGCAGGAAGAAGG + Intronic
1070635683 10:78125376-78125398 CAGTAGAAACAGAGTGAGGAAGG + Intergenic
1070690719 10:78522829-78522851 CAGCAGAAGCACAATTACAAAGG - Intergenic
1070718898 10:78742949-78742971 CAGCAGCAGCAAAATAAACAAGG + Intergenic
1070791010 10:79189360-79189382 CATCAGAGGCAGAAGGAAGCTGG - Intronic
1070884983 10:79885790-79885812 CAGGAGATGCTGAATAAAGATGG - Intergenic
1070887922 10:79921142-79921164 CAGCAGGAGAAGAAGGAAAAGGG - Intergenic
1071076951 10:81766353-81766375 CAGCTAAAGCAGTATTAAGAGGG - Intergenic
1071110613 10:82150723-82150745 CAGCAGAAGCAGATGAAAGACGG - Intronic
1071877817 10:89861504-89861526 AGGCAGAAGAAGAAAGAAGAAGG - Intergenic
1071945532 10:90639573-90639595 CTCCATTAGCAGAATGAAGAGGG + Intergenic
1071950238 10:90695818-90695840 CAGCAAAAGCAGTACTAAGAAGG - Intergenic
1072422039 10:95297333-95297355 CAGCAGGGACAGAATGAACAAGG + Intergenic
1072674335 10:97454271-97454293 CAGCAGAAATACAATCAAGATGG - Intronic
1072873603 10:99148116-99148138 CAGAACATGCAGAATAAAGAAGG + Intronic
1072953226 10:99866835-99866857 CAGCTAAAGCAGTATTAAGAGGG - Intergenic
1073340775 10:102742906-102742928 CAGAAGAAGCAGCAAGGAGATGG + Exonic
1073576570 10:104631046-104631068 CAGCAGCTGCAGGATGGAGAGGG - Intergenic
1074056216 10:109924485-109924507 CAGCTGAAGAAGAGTGAGGAAGG - Intergenic
1074171907 10:110948720-110948742 CAGCAAAAGCAGTTTTAAGAGGG + Intronic
1074388087 10:113033201-113033223 CAGCAGAAGGAGGAGGAGGAAGG - Intronic
1074409083 10:113209625-113209647 CAGCAGAAGCAGTACTAAGAGGG + Intergenic
1074476690 10:113780800-113780822 CAGCAGAACCAGGATGGAGCTGG + Intronic
1074626480 10:115193849-115193871 CAGCAAAAGCAGTACTAAGAGGG - Intronic
1075403430 10:122177635-122177657 GAGCAGCAGGAGAATGAAGCTGG + Intronic
1075721794 10:124591728-124591750 CAGCTGAAGCAGGATTCAGAGGG - Intronic
1075968098 10:126630297-126630319 CTGCAGATGCTGGATGAAGAGGG + Intronic
1076297746 10:129400323-129400345 CAGCAGAAGGTGAATGACAATGG - Intergenic
1076492192 10:130869443-130869465 AAACAGAAACAGAATGAAGTAGG - Intergenic
1076531312 10:131147131-131147153 CGGCAGCAGCAGAATTAAAAGGG + Intronic
1077202220 11:1315852-1315874 CAGCAAAAGCAGAGCTAAGAGGG - Intergenic
1077428574 11:2501032-2501054 CAGCAAAAGCAGTATTAAGAGGG + Intronic
1077651353 11:3975624-3975646 AAGAAGAAGAAGAAGGAAGAAGG + Intronic
1077887240 11:6395210-6395232 CAGCAGGGGCAGAAGGAGGAAGG - Exonic
1078001410 11:7499680-7499702 TAGGAGAAGCAGAAGGAACATGG + Intronic
1078357948 11:10646881-10646903 TAGCTGAAGGAGAATGAGGAAGG - Intronic
1078393862 11:10961099-10961121 CAGCAAAATCAGTTTGAAGAAGG + Intergenic
1078412732 11:11140789-11140811 CAGCAGAAATAGAATGTAGAGGG - Intergenic
1078724178 11:13913912-13913934 CTACAGCAACAGAATGAAGAGGG - Intergenic
1079257096 11:18840604-18840626 CAGCTAAAGCAGTATTAAGAGGG + Intergenic
1079845834 11:25466616-25466638 CAGCAAAAACAGAACCAAGAGGG + Intergenic
1080659837 11:34286709-34286731 GAGCAGAAACAGCATGAAAATGG - Intronic
1081064731 11:38526763-38526785 CAGCAAAAGCAGTGTTAAGAGGG + Intergenic
1081515943 11:43829738-43829760 CACCAGAAACAGAATAAGGAAGG - Intronic
1082776735 11:57251052-57251074 CAGCAGAGGCTGAAAGAAGGTGG + Intergenic
1082935202 11:58648983-58649005 CAGCAAAAGCAGTACTAAGAGGG - Intronic
1083041670 11:59693856-59693878 CAGCAAAAGCAGTAGTAAGAGGG + Intergenic
1083345513 11:61987976-61987998 CAGCTAAAGCAGTATTAAGAGGG + Intergenic
1083507290 11:63170155-63170177 CAGCAAAAGCAGTATTAAGAGGG + Intronic
1083984310 11:66201440-66201462 CAGCAAAAGCAGTACCAAGAGGG + Intronic
1084508176 11:69583858-69583880 AAACAGAAGCAGAACAAAGAAGG - Intergenic
1085194025 11:74656227-74656249 CAGCAAAAGCAGTACTAAGAGGG - Intronic
1085335416 11:75690053-75690075 AAGAAGAAGTAGAAGGAAGAAGG - Intergenic
1085882691 11:80486424-80486446 GAGAGGAAGCATAATGAAGATGG + Intergenic
1086096478 11:83054920-83054942 CCTCAGAAGCAGCAAGAAGATGG + Intronic
1086184899 11:84001934-84001956 CAGCAAAAGCAGTACTAAGAGGG + Intronic
1086194309 11:84118692-84118714 CAGCAGCAGAAGCAGGAAGATGG + Intronic
1086221494 11:84450434-84450456 CAGCAGGAGCAAAAGCAAGAAGG + Intronic
1086274751 11:85113143-85113165 CAGCAGCAGCAGAGTACAGAAGG + Intronic
1086422221 11:86648248-86648270 CAGCTAAAGCAGTATTAAGAGGG + Intronic
1086547992 11:88020940-88020962 CAACAAAAGCAGTATTAAGAGGG + Intergenic
1086586014 11:88452043-88452065 CAGCAGAAGCAAAATAAGCATGG - Intergenic
1086837582 11:91644348-91644370 CAGCAGATGCAGATTTCAGAAGG - Intergenic
1086850989 11:91808258-91808280 CAGCAAAAGCACTATTAAGAGGG - Intergenic
1087031583 11:93711253-93711275 CAGCAAAAGCAGTACTAAGAGGG - Intronic
1087392096 11:97548983-97549005 CAGCAGAAGCAGTACTAAGAAGG + Intergenic
1087564836 11:99841652-99841674 AAGGAGAAGGAGAATGAAGAAGG + Intronic
1087699588 11:101420668-101420690 CAGCAAAAGCAGTACTAAGAGGG - Intergenic
1088383109 11:109218859-109218881 CAGCTAAAGCAGTATTAAGAGGG - Intergenic
1088630114 11:111766358-111766380 CAGCAGGAGGAGAAAGAACATGG - Exonic
1088712673 11:112522824-112522846 TTCCAGAAGCAGAATGGAGAAGG + Intergenic
1088883083 11:113986876-113986898 CACCAGCCGCACAATGAAGATGG - Exonic
1089191232 11:116654768-116654790 CAGCATAAGCAGTATGAGGCTGG - Intergenic
1089688933 11:120174128-120174150 GAGCAGAGCCAAAATGAAGAGGG - Intronic
1089802683 11:121048579-121048601 TAGCAGAAACAGAATAAAGCTGG - Intronic
1089959089 11:122599835-122599857 CAGGGAAAGCAGAATGAGGAAGG - Intergenic
1090168141 11:124573359-124573381 CAGCAAAAGCAGAGTTTAGAGGG + Intergenic
1090329632 11:125920850-125920872 CAGCAGGAGCAGAGAGGAGAGGG + Intronic
1090464628 11:126923293-126923315 AAGGAGAAGGAGAAGGAAGAAGG - Intronic
1090464635 11:126923344-126923366 AAGGAGAAGGAGAAGGAAGAAGG - Intronic
1091096907 11:132831919-132831941 CAAAAGAAGGAAAATGAAGAGGG - Intronic
1091446739 12:548058-548080 CTGCACAAGCAGAATGAGGAGGG + Exonic
1091494872 12:963853-963875 CAGCAGAACTAGAGTGACGAGGG + Intronic
1091505319 12:1061920-1061942 CAGCAAAAGCAGTACAAAGAGGG - Intronic
1092060332 12:5545642-5545664 CAGGAGAAGTAGAAGGAAGGGGG + Intronic
1092240649 12:6834125-6834147 CAGGACAGGCAGAATGAAGGGGG - Intronic
1092442902 12:8524850-8524872 CAGCTAAAGCAGTATTAAGAGGG - Intergenic
1092456186 12:8644936-8644958 CAGCTGTAACACAATGAAGAAGG - Intronic
1092509416 12:9139077-9139099 CAGCAAAAGCACTATTAAGAAGG - Intergenic
1092519236 12:9250314-9250336 CAGCTGAAGCAGTGTGAAGAGGG + Intergenic
1092765311 12:11847683-11847705 GAGCAAAAGCAGATTGGAGAAGG + Intronic
1092791672 12:12076057-12076079 CAGTACAAGCAGAATGGACAGGG + Intronic
1092803865 12:12200584-12200606 CATCAGGAGCAGTATGCAGAGGG - Intronic
1092832816 12:12461694-12461716 CAGCAGCAGCAGAGTGGAGGAGG + Intronic
1093314728 12:17634148-17634170 CAGAACAAACAGAATGAAGGGGG - Intergenic
1093692278 12:22121874-22121896 CAGCAGAGAAAGAAGGAAGATGG - Intronic
1093795127 12:23301978-23302000 CAGGAGGAAAAGAATGAAGAGGG - Intergenic
1093987793 12:25556527-25556549 CAGAAAAAGCAGGATGAAGCTGG - Intronic
1094030589 12:26007479-26007501 CTGCAAGAGCAGAATGAAGAAGG + Intronic
1094129901 12:27063562-27063584 CAGAAGAAAAAGAAGGAAGAAGG - Intronic
1094271108 12:28616244-28616266 CAGCAAAAGCAGTACTAAGAGGG + Intergenic
1094440796 12:30474082-30474104 CAGCAAAAGCAGTATTAAAAGGG + Intergenic
1094491093 12:30961176-30961198 CAGCAGAAGAGGCAGGAAGAGGG - Intronic
1094786753 12:33858170-33858192 CAGCAAAAGCAGTACTAAGAGGG - Intergenic
1095190875 12:39256668-39256690 CAGAAATACCAGAATGAAGAGGG - Intergenic
1095227874 12:39698830-39698852 CAGCAAAAGCAGTACTAAGAGGG + Intronic
1095434499 12:42172410-42172432 CAGCTGAAGCATATTTAAGAAGG - Intronic
1095659693 12:44717041-44717063 GAGCACAAGCAGGATGAAGTTGG + Intronic
1095760144 12:45823293-45823315 CAGCAGAAGCAGTCCTAAGAGGG + Intronic
1095849298 12:46783886-46783908 CAACAGAAACAGTATGAAGCTGG + Intronic
1095899238 12:47310706-47310728 CAGCAAAAGCAGTAGTAAGAGGG + Intergenic
1096087248 12:48874013-48874035 AAGAAGAAGAAGAATGAGGAGGG + Intergenic
1096119477 12:49078449-49078471 GAGCAAATGCAGGATGAAGAAGG - Intergenic
1096204003 12:49706763-49706785 CAGCAGAAGGGGGAGGAAGAAGG + Intronic
1096373587 12:51089071-51089093 CAGGAGAAGCAGAATGATGTAGG + Intergenic
1096374778 12:51099678-51099700 CAGCAGCAGAAGCATGAGGATGG - Exonic
1096563911 12:52459797-52459819 CAGCAAAGGCAGTATTAAGAAGG - Intergenic
1096930674 12:55205199-55205221 CAGCAAAAGCAGTACTAAGAGGG + Intergenic
1097091390 12:56508153-56508175 GAGGAGAAGAAGAAGGAAGAAGG - Intergenic
1097146698 12:56945397-56945419 CAACAAAAGCAGAACTAAGAGGG - Intergenic
1097410337 12:59244784-59244806 CAGCTAAAGCAGTATTAAGAAGG + Intergenic
1097410424 12:59245960-59245982 CAGCTAAAGCAGTATTAAGAAGG - Intergenic
1097508072 12:60501409-60501431 CATGAGAAACAGAATGAATATGG + Intergenic
1097563327 12:61236060-61236082 CAGCAAAAGCAGCACAAAGAAGG - Intergenic
1097714412 12:62951281-62951303 CAGCAAAAGCAGTACTAAGAGGG - Intergenic
1097739467 12:63222604-63222626 CAGCGGAACCAAAATAAAGAAGG + Intergenic
1097770231 12:63575309-63575331 CAGCAAAAGCAGTATTAAGAGGG + Intronic
1097791586 12:63821332-63821354 CAGCAAAAGCAGTACTAAGAGGG + Intergenic
1097977520 12:65703429-65703451 CAGCAAAAGCAGTATTAAGATGG - Intergenic
1098060626 12:66557808-66557830 CAGCAAAAGCAGCACTAAGAGGG + Intronic
1098179612 12:67832259-67832281 CAGGAGAGGCAGATGGAAGATGG + Intergenic
1098346844 12:69514418-69514440 GAGCAGAAGCAGAGAGCAGAAGG - Intronic
1098559971 12:71861834-71861856 CAGCAAAAGTAGTATTAAGAAGG - Intronic
1098572498 12:72004714-72004736 TAGCAAAAGCAGAAAGAAGATGG + Intronic
1098830277 12:75352985-75353007 CAGCTAAAGCAGTATTAAGAGGG + Intronic
1099163838 12:79276934-79276956 GAGAAGAAGAAGAAGGAAGAAGG + Intronic
1099280227 12:80634949-80634971 CGACAGAAGCAGAAAGAAGGTGG + Exonic
1099388083 12:82042867-82042889 CAGCAAAAGCAGTACCAAGAAGG + Intergenic
1099495347 12:83339829-83339851 CACCACAAGCAGATTGAAGAAGG + Intergenic
1099732469 12:86523241-86523263 CAGCAAAGGCAGTATTAAGAGGG - Intronic
1099950044 12:89291825-89291847 CTGAAGAAGGAGAAAGAAGAGGG + Intergenic
1099992549 12:89740293-89740315 CAGCAAAAGCAGTACTAAGAAGG + Intergenic
1100136562 12:91559771-91559793 CAGCAAAAGCAGCATTTAGAGGG + Intergenic
1100290960 12:93214753-93214775 CAGCTGTAGCAGTATGGAGAGGG + Intergenic
1100393208 12:94162354-94162376 GAGCAGAAGCAGAGTGCAGGAGG + Intronic
1100642357 12:96494165-96494187 TAGCAGAAGCAGAGTGAAAGAGG + Intronic
1100996424 12:100305494-100305516 CAGCTAAAGCAGTATGTAGAGGG + Intronic
1101110403 12:101480952-101480974 GAGCTGAAGTAGAAAGAAGAAGG - Intronic
1101226982 12:102698074-102698096 CAGCAAAAGCAGTACTAAGAGGG + Intergenic
1102167964 12:110821038-110821060 GAGAAGAAGAAGAAAGAAGAAGG - Intergenic
1102689560 12:114749779-114749801 CAGCAGAAGAAAAAAGAAAAGGG + Intergenic
1102865218 12:116368887-116368909 GAGGGGAAGCAGAATGTAGACGG + Intergenic
1102899320 12:116624090-116624112 AAGGAGAAAGAGAATGAAGAAGG + Intergenic
1102940981 12:116941504-116941526 TAGCAGAAGCATAATTAAGGAGG + Intronic
1102974978 12:117200190-117200212 AAGGAGAAGAAGAAAGAAGAAGG - Intergenic
1103044826 12:117727395-117727417 CAGAAAAAGAAGAAAGAAGAAGG + Intronic
1103988853 12:124785034-124785056 CTCCAGAAGCAGCAGGAAGAGGG - Intronic
1104013777 12:124949396-124949418 GAGCAGAAGCAGGAGGCAGAGGG + Intronic
1104812850 12:131628889-131628911 CAGCAGGTGCAGAGTGAGGAGGG - Intergenic
1105323578 13:19349851-19349873 CGGCAGAGGCAGAAAGAAGTGGG - Intergenic
1105365647 13:19761921-19761943 CTTCAGAAACAGAATTAAGAGGG + Intronic
1105652135 13:22390622-22390644 CAGCATAAAGAGAATGAAAAGGG - Intergenic
1105870373 13:24499649-24499671 CGGCAGAGGCAGAAAGAAGTGGG + Intronic
1106449474 13:29866983-29867005 CAGCAGAAGGGGAAAGAACATGG + Intergenic
1106572047 13:30935475-30935497 CAGCAGCCAGAGAATGAAGAGGG + Intronic
1107155319 13:37159739-37159761 CAGCAAAAGCAGTATTAAGAGGG - Intergenic
1107217053 13:37934328-37934350 CAGCACAAGGAGAATGGAGAAGG + Intergenic
1107300168 13:38957917-38957939 CCGCAGAAGTAGAATGCACAGGG + Intergenic
1107383774 13:39885941-39885963 CAGCAAAAGCAGTATTAAGAGGG + Intergenic
1107551860 13:41483945-41483967 CAGCAAAAGCAGTACTAAGAAGG - Intergenic
1107771794 13:43794627-43794649 CTGCAGAGGCAGTATGTAGATGG - Intergenic
1108160692 13:47635297-47635319 CAGCTAAAGCAGAGTTAAGAGGG + Intergenic
1108301583 13:49082740-49082762 GAGCCCAAGCAGACTGAAGAGGG + Intronic
1108714451 13:53065052-53065074 CAGCCAAAGCAAAATGATGATGG + Intergenic
1108993808 13:56699127-56699149 CAGCAGATGAACAATCAAGAAGG - Intergenic
1110486857 13:76055728-76055750 CAGCAAAAGCAGTACTAAGAGGG + Intergenic
1110491542 13:76115188-76115210 CAGCAAAAGCAGTACAAAGAGGG + Intergenic
1110501549 13:76234051-76234073 CAGCAAAAGCAGTACTAAGAGGG + Intergenic
1110995457 13:82102302-82102324 CAGCAAAAGCAGTACTAAGAGGG - Intergenic
1111030769 13:82594568-82594590 CAGCAAAAGCAGTACTAAGAGGG + Intergenic
1111176635 13:84604742-84604764 CAGCAAAAGCAGACCTAAGAGGG - Intergenic
1111218462 13:85175369-85175391 CTGCTGAAGAAGAATGAGGAAGG + Intergenic
1111340121 13:86873466-86873488 CAACAAAAGCATAAGGAAGATGG + Intergenic
1111656063 13:91155219-91155241 CAACAGAAGCAGCAGCAAGAAGG + Intergenic
1111716292 13:91883623-91883645 TAGCTGAAGCAGAGTGAGGAAGG + Intronic
1112171823 13:96980590-96980612 CATAAGAAGAAGAGTGAAGATGG + Intergenic
1112250451 13:97774481-97774503 CAACAGAGGCAGATGGAAGAAGG - Intergenic
1112688935 13:101867003-101867025 CTGGAGAATCAGAAGGAAGAAGG + Intronic
1112717660 13:102205128-102205150 CAGCAGAAACTGAGAGAAGAAGG + Intronic
1113353755 13:109556760-109556782 CAGCAAAAGCAGATCTAAGAGGG + Intergenic
1113785037 13:112997962-112997984 CAGCAGCAGCTGTATGAAGCCGG + Intronic
1114159538 14:20149098-20149120 TAGCAAAAGCAGAACAAAGAGGG - Intergenic
1114402305 14:22421056-22421078 CTGCAGAAGCAGAAGGACTATGG - Intergenic
1114650619 14:24282219-24282241 AAGCAGAAGCAGCATGATGCAGG + Intergenic
1114860725 14:26517228-26517250 TAGCAGCAGCAGAATGAGCAAGG - Intronic
1114876037 14:26719401-26719423 AAGCAGAAGTAAAATGTAGAGGG + Intergenic
1114970763 14:28025674-28025696 CATTAGAACCAAAATGAAGAAGG + Intergenic
1114987551 14:28250049-28250071 CAGCAAAAGAAAAATGAGGAAGG + Intergenic
1115024764 14:28730348-28730370 TAGCAGAAACAGGATGACGAAGG - Intergenic
1115095383 14:29629943-29629965 AAGGAGAAGGAGAAGGAAGAAGG - Intronic
1115279379 14:31644301-31644323 CAGGAAAAACAGTATGAAGATGG - Intronic
1116058207 14:39889530-39889552 CAGCAAAAGCAGTACTAAGAGGG + Intergenic
1116062885 14:39946748-39946770 CAGCAAAAGCAGAACTAAGAGGG - Intergenic
1116402165 14:44521295-44521317 CAGCAGCAGCACACTGTAGAAGG - Intergenic
1116450331 14:45057599-45057621 CAGCAAAAGCAGTGTTAAGAGGG - Intronic
1116484652 14:45433064-45433086 CAGCTAAAGCAGTATTAAGAGGG - Intergenic
1116747869 14:48844958-48844980 CAGCAGAAGGTGGAAGAAGATGG + Intergenic
1117184284 14:53224192-53224214 CAGCAAAAGCAGTATTAAGGGGG - Intergenic
1117194858 14:53329647-53329669 CAGCAGAGGGGGAATGAGGATGG - Intergenic
1117498235 14:56326983-56327005 CAGCTGAAGAACAAGGAAGAAGG - Intergenic
1117751327 14:58926712-58926734 CAGCAAAAGCAGTGTTAAGAAGG + Intergenic
1117879896 14:60302968-60302990 CATCTAAAGCAGACTGAAGAAGG - Intergenic
1117937904 14:60927699-60927721 GAGCAGAAACAGAAAGAAGGTGG - Intronic
1118538715 14:66798963-66798985 CAGCAAAAGCAGTACTAAGAGGG - Intronic
1118562785 14:67104989-67105011 CAGCAAAAACAGCATTAAGAGGG - Intronic
1118641112 14:67793478-67793500 CAGAAGAAGCAGAAGCAAGAGGG - Intronic
1119036209 14:71231946-71231968 CAGCAGAGGAAGAAAGATGATGG + Intergenic
1119205498 14:72790943-72790965 CACCAGGAGCAGAGGGAAGAGGG - Intronic
1119433085 14:74581065-74581087 GAGCAGAAGCAGGATGAACACGG + Intronic
1119464403 14:74843683-74843705 CAGCAGAAGCAGAATAAAACAGG + Intronic
1119606029 14:76018198-76018220 CAGCAAAAGCAGAGCCAAGAGGG - Intronic
1120533574 14:85664311-85664333 CCGGGGAAGCAGAATGATGAGGG + Intergenic
1120853963 14:89196779-89196801 CAGAGGAAGCGGAATGAACATGG - Intronic
1121373878 14:93387388-93387410 CAGCAAAAGCAGAACTAAGAAGG - Intronic
1121376985 14:93420946-93420968 TAGCAAAAGCAGTATGAAGATGG + Intronic
1121664263 14:95660045-95660067 CAGCAGGATCAGAGTGAGGAAGG - Intergenic
1121684311 14:95821737-95821759 CAGGAGAAAGAGAATGCAGAGGG - Intergenic
1121982697 14:98468569-98468591 CAGCTGCACCAGAATGAATAGGG - Intergenic
1122038161 14:98963298-98963320 AAGGAGAAGGAGAAAGAAGAAGG + Intergenic
1122155239 14:99746727-99746749 CACCAGCAGCAGAATGGGGATGG - Intronic
1122969536 14:105146920-105146942 CTGCAGAAGCAGACGGAGGAGGG - Intronic
1123111758 14:105873369-105873391 CAGCAAAAGCAGTACTAAGAGGG - Intergenic
1125113606 15:36062908-36062930 CACCAGTAGGAGAATGGAGAGGG - Intergenic
1125186876 15:36941033-36941055 CTGCAGAAGAAGAATGGAGGGGG - Intronic
1125691475 15:41599527-41599549 CAGCAGAAGGAGAGTGAGGGTGG + Intergenic
1126015895 15:44349983-44350005 CAGCGAAAGCAGAACTAAGAGGG + Intronic
1126552716 15:49950851-49950873 CAGCTAAAGCAGCATTAAGAGGG - Intronic
1126680426 15:51196963-51196985 CAGCAGATGCGGAATGACCATGG - Intergenic
1126860701 15:52879974-52879996 GAGCAGAAAGAGAAGGAAGAGGG - Intergenic
1126944034 15:53798063-53798085 TAGCAAAAGCAGAACTAAGAAGG + Intergenic
1126989715 15:54359965-54359987 CAGCACAAGCAGTTTTAAGAGGG - Intronic
1127019523 15:54730634-54730656 CAGTAGCAGAAGAATGCAGAAGG + Intergenic
1127069436 15:55274236-55274258 CAGGAGAAGCAGTTTTAAGAGGG + Intronic
1127740091 15:61895202-61895224 CAGCAAAAGCAGCACTAAGAGGG + Intronic
1127784447 15:62343372-62343394 CAGCAGAAGCAGCTGGCAGAAGG + Intergenic
1127997636 15:64162903-64162925 CGGCAGCAGCAGGAAGAAGACGG + Exonic
1128033466 15:64502080-64502102 CAGCAGAATGAGAAAGAAAAGGG + Intronic
1128095618 15:64952324-64952346 AAGAAGAAGGAGAAGGAAGAAGG - Intronic
1128095631 15:64952461-64952483 AAGAAGAAGGAGAAGGAAGAAGG - Intronic
1128095748 15:64953691-64953713 AAGGAGAAGAAGAAAGAAGAAGG - Intronic
1128160521 15:65420746-65420768 CTGTAGAAGGAGAATGATGATGG - Intronic
1128267340 15:66278497-66278519 CAGCAGAAGCATAATAATGCTGG + Intergenic
1129527976 15:76234592-76234614 CAACAGAAACAGAAAGAAGGAGG + Intronic
1129919911 15:79311272-79311294 CAGCAGAAGCAGCACGGAGGCGG - Exonic
1130068789 15:80629053-80629075 CAGGAGGAGGAGAATGAAGGGGG + Intergenic
1130573003 15:85065737-85065759 CTTCAGAAGCAGACTGAAAATGG - Intronic
1130894913 15:88162460-88162482 CAGCAGAAGGAGAGGGGAGAAGG + Intronic
1130928679 15:88404512-88404534 CAGCAGAAGAAAAGTGAATATGG + Intergenic
1132124196 15:99206952-99206974 CAGCAAAAGCAGTACTAAGAGGG - Intronic
1132976535 16:2713893-2713915 CAGCAGACCCAGAAGGAAGAGGG - Intronic
1133543578 16:6782315-6782337 CAGCAAAAGCAGTACTAAGATGG - Intronic
1133621492 16:7530923-7530945 CAGCAGCAGCAGAATGTACCTGG + Intronic
1133966530 16:10535951-10535973 CAGCAGATGCTGATTCAAGAGGG + Intronic
1134652451 16:15920800-15920822 CCCCAGAAGAAGAATGGAGATGG - Intergenic
1135262765 16:20995681-20995703 TAGCTGAATCAGAATGGAGAAGG - Intronic
1135507987 16:23055613-23055635 CAGCAGGAACAGACTAAAGATGG + Intergenic
1135822287 16:25694646-25694668 CAGCAACAGCAAAATAAAGAAGG + Intronic
1136407807 16:30058903-30058925 CAGCAGAAACAAGATGGAGAAGG + Intronic
1136539119 16:30918826-30918848 GAGAAGAAGAAGAAAGAAGAAGG - Intergenic
1137002070 16:35237837-35237859 ATGCAGAATCAGAATGAAGTAGG - Intergenic
1137317842 16:47346412-47346434 CAGCAGAAGCAGTAGTCAGAGGG + Intronic
1137402748 16:48166576-48166598 CGTAAAAAGCAGAATGAAGATGG + Intergenic
1137530597 16:49276549-49276571 CAGCAGGTGGAGAAAGAAGAGGG + Intergenic
1137884396 16:52086926-52086948 CACTAGAAGCAGAAGGAGGAGGG + Intergenic
1137960358 16:52876423-52876445 CACCAGAAGCAGAAAAATGAGGG + Intergenic
1138690395 16:58762430-58762452 CAGAAAAAGAAGAATGAAGTTGG - Intergenic
1139447461 16:67006666-67006688 CAGCAGAAGCAGCAGGAGTAGGG + Intronic
1140219396 16:73032980-73033002 CAGCAGGAGCAGGATGGGGAAGG + Intronic
1140970494 16:80007796-80007818 CAGCAGAAGGCGAATGGACACGG - Intergenic
1141038259 16:80648002-80648024 CAGCTAAAGCAGTATTAAGAGGG + Intronic
1141216118 16:82025346-82025368 CACCAGAAGCTGAAAGAAGCAGG - Intergenic
1141274549 16:82574817-82574839 CAGCAGAAGCAGAAATCAGAGGG - Intergenic
1141368890 16:83469121-83469143 CAGCAGAAGCAGAAAGTTCAAGG + Intronic
1141371727 16:83493231-83493253 CTGAAGAAGCAGAAAGAAGTTGG + Intronic
1141372406 16:83500367-83500389 AAGAAGAAGAAGAAAGAAGAAGG - Intronic
1141623285 16:85248390-85248412 CAGAGGAAACAGAAAGAAGAGGG - Intergenic
1142273693 16:89104601-89104623 CAGGAGAAGCAGAGGGAAGGTGG - Intronic
1142946068 17:3428312-3428334 CAGCAAAAGCAATATTAAGAGGG + Intergenic
1143395407 17:6590978-6591000 AAGAAGAAGAAGAAAGAAGAAGG + Intronic
1143814031 17:9496760-9496782 CATCAGAGGGAGTATGAAGAAGG + Intronic
1143852952 17:9826215-9826237 CAGCAGGACCAGAGTGAGGAAGG - Exonic
1144133305 17:12268438-12268460 TGCCAGAAGCAGAGTGAAGATGG - Intergenic
1144573765 17:16416385-16416407 GAGCAGGATCAGAAAGAAGAAGG - Intronic
1144701110 17:17340968-17340990 CAGCAAAAGCAGTACTAAGAGGG - Intronic
1144841211 17:18187146-18187168 CTGCAGAAGCACACTGAAGGGGG + Intronic
1145771004 17:27493071-27493093 CATCATCAGCAGAATGATGAAGG - Intronic
1145824648 17:27867633-27867655 CTTCAGAAGCAAAATGAAGAAGG - Intronic
1145898418 17:28474196-28474218 AAGCAGCAGCAGAGTGAAGAGGG + Intronic
1145903250 17:28501433-28501455 GAGCGGAAGCAGACAGAAGATGG + Intronic
1146208739 17:30925541-30925563 AAGAAGAAGAAGAAGGAAGAAGG - Intronic
1146320128 17:31840461-31840483 CAACAGAAGAGGAATGAATATGG + Intergenic
1146543774 17:33720266-33720288 CTCCAGAAGCAGAATTAAGAAGG + Intronic
1147053979 17:37819716-37819738 CAACAGAAGAAGGAGGAAGAGGG - Intergenic
1147773906 17:42887007-42887029 CAGCAGAGGCAGCAGGAAGAGGG + Intergenic
1148700756 17:49585409-49585431 CACCAACAGCAGAATGTAGATGG - Intergenic
1148858407 17:50591581-50591603 GAGCATAAGCAGCATGCAGAAGG - Exonic
1149160179 17:53683984-53684006 CAGCAAAAGCAGTATTTAGAGGG - Intergenic
1149797906 17:59538419-59538441 AAGAAGAAGAAGAAGGAAGAAGG - Intergenic
1150143996 17:62752772-62752794 GAGCAAAAGCAAAAGGAAGAGGG - Intronic
1150196162 17:63301929-63301951 CAGCAAAAGCAGTGTTAAGAGGG - Intronic
1150236844 17:63600305-63600327 CAGCAGAGAGAAAATGAAGAGGG + Intergenic
1150402758 17:64872411-64872433 CAGAGGGAGCAGAATGGAGATGG + Intronic
1150618133 17:66787930-66787952 CACCAGAAGTAGAATGGATAAGG - Intronic
1150897558 17:69231416-69231438 CAGCAAAAGCAGTTTTAAGAGGG - Intronic
1151264424 17:72943283-72943305 CATCAGAAGCAGAACCAATAAGG + Intronic
1153099890 18:1454999-1455021 CAGCAAAAGCAGTACTAAGAAGG + Intergenic
1153414021 18:4825461-4825483 AAGCAGCAGCAGCAGGAAGAGGG - Intergenic
1153425995 18:4964396-4964418 CAGCAGAAGCAGTACTAAGAGGG + Intergenic
1153748621 18:8206969-8206991 CACCAGAAGCTGAAAGAACAAGG + Intronic
1153749043 18:8210443-8210465 CACCAGAAGCTGAAAGAACAAGG + Intronic
1153792361 18:8590384-8590406 CAGCAAAAGCAGCATTTAGAGGG + Intergenic
1154087049 18:11316874-11316896 GTGAAGAAGCAGAATGAAAAAGG - Intergenic
1155433367 18:25785609-25785631 CAGCAGAGGCAGAGGGGAGAGGG - Intergenic
1155534180 18:26798883-26798905 CAGCAAAAGCAGTACTAAGAGGG + Intergenic
1155807415 18:30189483-30189505 CAGCAGAAGCAGTGTTAAGAGGG - Intergenic
1156425020 18:37000882-37000904 CAGCAAAAGCAGCACCAAGAGGG + Intronic
1156738109 18:40288267-40288289 CAGCAAAAGCACTATTAAGATGG + Intergenic
1157022469 18:43802547-43802569 CAGCAAAAGCAGTAATAAGAGGG - Intergenic
1157469129 18:47974670-47974692 CAGCAACAGCAGAAGCAAGAAGG + Intergenic
1157886669 18:51374131-51374153 CAGCAAAAGCAGTACTAAGAGGG + Intergenic
1159231027 18:65606815-65606837 CAGGAGGAAGAGAATGAAGAGGG - Intergenic
1159783786 18:72690745-72690767 AAGTAGAAGCAGAAGGAAGCAGG + Intergenic
1159872437 18:73773760-73773782 CAGGAGCTGCAGAATTAAGAAGG - Intergenic
1160761816 19:789291-789313 CAGCAGAGGCAGAATTGGGAGGG - Intergenic
1161746102 19:6061128-6061150 CAGCAGGAGCGGAAGGAAGGGGG - Intronic
1162084459 19:8240225-8240247 CAGCAGGGCCAGAATGTAGAGGG + Intronic
1162688014 19:12403899-12403921 CAGCAAAAGCAGTACTAAGAGGG - Intronic
1162692332 19:12443692-12443714 CAGCAAAAGCAGTACTAAGAGGG - Intronic
1163099631 19:15086885-15086907 CAACAGAAGCCCACTGAAGATGG + Intergenic
1163194853 19:15709701-15709723 CAGCAAAAGCAGTATTAAGAAGG + Intergenic
1163219579 19:15906606-15906628 CAGCAAAAGCAGTATTAAGAAGG - Intergenic
1164411721 19:28011835-28011857 CACCAGAATCTGAAAGAAGAAGG + Intergenic
1164681083 19:30134133-30134155 CATGAGAAGCAGAATTCAGATGG - Intergenic
1164718639 19:30415046-30415068 AAGCAGAAGCAGGAAGAAGAAGG - Intronic
1164743656 19:30595093-30595115 CAGGAGAGGCACAATGAAGTTGG + Intronic
1165106007 19:33470034-33470056 CTGCTGAAGCAGCAGGAAGATGG - Intronic
1165422986 19:35731661-35731683 CAGCAGAGGCAGAGAGGAGATGG + Intronic
1165566511 19:36733829-36733851 CAGCAAAAGCAGTATTAAGAAGG + Intronic
1166108860 19:40610869-40610891 ATGGAGAAGCAGAATGAGGAGGG + Intronic
1166140367 19:40802158-40802180 CAGGAGAAGCAGAAGGGGGAGGG + Intronic
1166245976 19:41526128-41526150 CAGCAAAAGCAGAACTAAGAAGG + Intergenic
1166348226 19:42179950-42179972 CAGCAGATGCATAATGGACATGG + Intronic
1166757505 19:45202488-45202510 CACCACAAGCTGACTGAAGAGGG - Exonic
1166869241 19:45861276-45861298 AAGCAGAAGAAGAATGAAACAGG - Intronic
1166904497 19:46097659-46097681 CAGCTAAAGCAGTATTAAGAGGG - Intergenic
1166920465 19:46225994-46226016 TAAAAGAAGAAGAATGAAGAAGG + Intergenic
1167401183 19:49271070-49271092 CAGCAAAAGCAGTACTAAGAGGG + Intergenic
1168375149 19:55870789-55870811 CACGAGAAGGAGAGTGAAGAGGG - Intronic
925011181 2:487690-487712 CAGCAGAACCAGAACGAATGCGG - Intergenic
925028717 2:632234-632256 CAGCTAAAGCAGTATGTAGAGGG + Intergenic
925084575 2:1097910-1097932 CCTCACAAGCAGAATGCAGACGG + Intronic
925165371 2:1712661-1712683 CAGCAGAACTAAAATGAAAACGG + Intronic
925177662 2:1796704-1796726 CAGCAGGAGCAGAAGGAGGATGG - Intronic
925717560 2:6798258-6798280 CAGGAAAAGCAAAATGAGGAGGG + Intergenic
925894284 2:8459410-8459432 CAGGATAAGCAGAGGGAAGAGGG - Intergenic
926001115 2:9333561-9333583 GAGAAGAAACAGAATGCAGAGGG + Intronic
926819320 2:16835212-16835234 CAGCATAAGGAGCATGCAGACGG - Intergenic
926873439 2:17448541-17448563 CAGCTAAAGCAGTATTAAGAGGG + Intergenic
927161543 2:20267523-20267545 CAGCAGCAGAAGTATGAATATGG - Intronic
927587951 2:24326366-24326388 TGGAAGAAGCAGAATAAAGAAGG + Intronic
927864528 2:26580196-26580218 CAGCCTAGGCAGAATGCAGAAGG - Intergenic
928190010 2:29155681-29155703 CAGCAGAAACTGAATGAAGAGGG - Intronic
928196515 2:29220277-29220299 TGGCAGGAGCAGAATGAAGGGGG - Intronic
928325881 2:30319167-30319189 CAGCAGCAGCAGAAAGAGGTGGG + Intronic
928415584 2:31088934-31088956 CAGCAGATGCAGATACAAGAAGG + Intronic
928436725 2:31259265-31259287 CAGCAGCAGTCGCATGAAGATGG - Intronic
928459725 2:31459320-31459342 CAGCAAAAGCAGTACTAAGAGGG + Intergenic
928783877 2:34857912-34857934 CAGCAAAAGCAGTACTAAGAGGG + Intergenic
928865616 2:35914307-35914329 CAGCAGCAGCAGTAGCAAGAGGG - Intergenic
929684893 2:44025060-44025082 CAAGAGAGGCAGAAAGAAGAGGG - Intergenic
929726480 2:44434152-44434174 CAGCATACACATAATGAAGACGG - Intronic
929898422 2:45981460-45981482 AAGCAGAAGGAGAGAGAAGATGG - Intronic
930019055 2:46990099-46990121 CAACAGCAGCAGGCTGAAGAGGG - Intronic
930527776 2:52551888-52551910 CAGCAAAAGCAGTATTAAGAGGG + Intergenic
930546207 2:52770485-52770507 CAGCTAAAGCAGTGTGAAGAGGG + Intergenic
930818534 2:55622463-55622485 AGGCAGAAGCAGGATGAAAAGGG - Intergenic
930837067 2:55805692-55805714 AAGCAGCAGCAGAATTAACATGG - Intergenic
930972419 2:57412136-57412158 CAGCAAAAGCAGTACTAAGAAGG + Intergenic
930986742 2:57598429-57598451 CAGCACAGGCAAGATGAAGATGG + Intergenic
931085701 2:58828090-58828112 CAGCGGAAGCAGTACTAAGAGGG - Intergenic
931208820 2:60173117-60173139 GAGCTGAAGAAGAAAGAAGAGGG + Intergenic
931464558 2:62475124-62475146 CAGGAGAAGCAGCAGGAAGGGGG + Intergenic
931483678 2:62669056-62669078 AGGCAGAAGCAGAAGAAAGACGG - Intergenic
931989966 2:67780187-67780209 CAGCAAAAGCAGTACTAAGAGGG + Intergenic
931992776 2:67807774-67807796 GAGAAGAAGGAGAAGGAAGAAGG - Intergenic
932025899 2:68132298-68132320 AATCAGAAGCAGAATGGAAAGGG + Intronic
932697462 2:73968672-73968694 CAGCAGAAGCTTCCTGAAGATGG - Intergenic
932765064 2:74464414-74464436 CAGCAAATGCAGCATGAAGTGGG - Intronic
933068310 2:77826993-77827015 CAGCAAAAGCAGTAGTAAGAGGG - Intergenic
933129775 2:78657810-78657832 CAGCTAAAGCAGCATTAAGAGGG + Intergenic
933332925 2:80917605-80917627 CAGCAAAAGCAGTACTAAGAGGG - Intergenic
933388458 2:81640881-81640903 CAGCAAAAGCAGTACAAAGAGGG + Intergenic
933564330 2:83931264-83931286 CAGCAAAAGCAGTACTAAGAGGG + Intergenic
934161657 2:89255241-89255263 CAGCTGAAGCAGGATGAGCAGGG + Intergenic
934205627 2:89927174-89927196 CAGCTGAAGCAGGATGAGCAGGG - Intergenic
934631584 2:95930924-95930946 AAGCAGAAGCAGAAGTTAGAAGG - Intronic
934802063 2:97173761-97173783 AAGCAGAAGCAGAAGTTAGAAGG + Intronic
935288373 2:101587212-101587234 GAGCAGAAGCAGCATAAAGAGGG - Intergenic
935410981 2:102761825-102761847 CCACAGAAGTAGAAAGAAGATGG - Intronic
935794724 2:106630100-106630122 CAGCAGAAACAGCATGAAGAAGG - Intergenic
935929688 2:108110774-108110796 CAGCTAAAGCAGAGTTAAGAGGG - Intergenic
935948119 2:108304407-108304429 AAGCAGAGACAGAAAGAAGAGGG + Intronic
936688767 2:114860725-114860747 GAGCTGAAGCAAAAAGAAGATGG - Intronic
937148138 2:119664998-119665020 CAGCTAAAGCAGTGTGAAGAGGG + Intergenic
937285258 2:120746524-120746546 AAACAGAAGCAGAAGAAAGAGGG - Intronic
937490877 2:122365941-122365963 AGGCAGAAGGAGAAAGAAGAAGG + Intergenic
938136547 2:128763364-128763386 CAGCTAAAGCAGTATTAAGAGGG - Intergenic
938260397 2:129891752-129891774 CAGCAGCAGCAGGAGGAGGATGG - Intergenic
938291047 2:130150679-130150701 GAGCAGAAGCAAAATGCAGTTGG - Intergenic
938396176 2:130950102-130950124 CAGCTGAAGGAGGATGAGGAAGG + Intronic
939080231 2:137651705-137651727 CAGCAAAAGCAGTATTAAGAGGG - Intronic
939106833 2:137958677-137958699 CAGAAGAAGAAAAATGAAAAAGG + Intergenic
939146529 2:138422034-138422056 CTGCAGAAGCACAGTGCAGAGGG + Intergenic
939453640 2:142404129-142404151 CAGCAAAAGAAGTATCAAGAGGG + Intergenic
939732980 2:145808359-145808381 CAGCAGAAACAGCAGGGAGAGGG - Intergenic
939767844 2:146275049-146275071 CAGCTAAAGAAGAATGAAAATGG - Intergenic
940616078 2:156050071-156050093 CAGCAAAAGCAGTGTTAAGAGGG + Intergenic
941518434 2:166508734-166508756 CAGCAAAAGCAGTGTTAAGAGGG - Intergenic
941695590 2:168547848-168547870 TAGTAGAAGCGGAATGAAGATGG + Intronic
941717830 2:168782278-168782300 CAGCATGAGTTGAATGAAGAAGG + Intergenic
941845945 2:170133251-170133273 CAGCAAAAGCAGTATGAAGAGGG + Intergenic
942228098 2:173834569-173834591 GAGCAGGAGCAGAATGAAAATGG + Intergenic
942248621 2:174029174-174029196 CTGCAGAAGGTGATTGAAGAGGG + Intergenic
942576699 2:177371356-177371378 CAGCTAAAGCAGCATGTAGAGGG - Intronic
942651298 2:178171188-178171210 CAGCAAAAGCAGTACTAAGATGG - Intergenic
943102292 2:183502444-183502466 CTGCAGAAGCAGTACTAAGAGGG - Intergenic
943484465 2:188462076-188462098 CAGCAAAAGCAGTACGAAGAGGG - Intronic
943787918 2:191899490-191899512 CAAAAGAAGCAGAAGGAAAACGG + Intergenic
943964466 2:194315035-194315057 CAAAAGAAACAGAATGAAAAGGG - Intergenic
944031823 2:195243497-195243519 CAGCCAAAGCAGTATTAAGAGGG + Intergenic
944097014 2:195979465-195979487 CAGCAAAAGCAGCACAAAGAGGG + Intronic
944346997 2:198680357-198680379 TAGCAAAAGCAGTATTAAGAGGG + Intergenic
944737575 2:202581696-202581718 CAGCAAAAGCAGTTAGAAGAGGG - Intergenic
945378313 2:209106718-209106740 CAGCAAAAGCAGTACTAAGAGGG + Intergenic
945475965 2:210282902-210282924 CAGCAAAAGCAGTATTAAGAGGG - Intergenic
945511317 2:210706501-210706523 CAGCAGCAGTTGAATGAAGAAGG + Intergenic
946329095 2:218999885-218999907 CAGCAGAAGAGAAATGGAGAAGG - Intergenic
946513749 2:220388438-220388460 CAGCAAAAGCAGTACTAAGAGGG - Intergenic
946528533 2:220546585-220546607 AAGGAGAAGAAGAAAGAAGAAGG - Intergenic
946983885 2:225249562-225249584 CAGGAGAAGGAGAATGAACTGGG + Intergenic
946984995 2:225261675-225261697 CAGCAAAAGCAGTACTAAGAGGG + Intergenic
947311932 2:228813229-228813251 CAGCAAAAGCAGTACAAAGAAGG - Intergenic
947479899 2:230489665-230489687 CAGCTAAAGCAGTATTAAGAGGG - Intronic
948475130 2:238212841-238212863 CAGCAAAAGCAGTACCAAGAGGG - Intergenic
1168744194 20:222463-222485 CAGCAAAAGCAGTACTAAGAGGG + Intergenic
1169043338 20:2515016-2515038 AAGAAGAAGAAGAAAGAAGAAGG + Intronic
1169047474 20:2545673-2545695 AAGAAGAAGAAGAAAGAAGAAGG + Intronic
1169318014 20:4609205-4609227 GAGCAGGGGCAGAAGGAAGAGGG + Intergenic
1169326602 20:4681794-4681816 GGGCAGAAGCAAATTGAAGAGGG - Intergenic
1169817585 20:9674133-9674155 CAGCAGAAACAGAATGAGAATGG + Intronic
1170099287 20:12680977-12680999 CCTCAGAGACAGAATGAAGATGG + Intergenic
1170209367 20:13833177-13833199 CTGCAAATGCAGAATGAAAATGG - Intergenic
1170490459 20:16867803-16867825 CAGCAAAAGCAGTACTAAGAGGG + Intergenic
1171200679 20:23239290-23239312 CAGCTAAAGCAGTGTGAAGAGGG - Intergenic
1171941129 20:31330955-31330977 AAGGAGAAGGAGAAGGAAGAAGG + Intergenic
1172113891 20:32562774-32562796 CTGCAGGAGCAGAATGGGGAGGG - Intronic
1172451772 20:35030452-35030474 CAGCACAAAAAGAATGAAGATGG - Intronic
1172574456 20:35996967-35996989 CAGGAAATGGAGAATGAAGAAGG - Intronic
1173630433 20:44509976-44509998 CAGCTGAATGAGGATGAAGAGGG + Exonic
1173765521 20:45605329-45605351 CAGCAAAAGCAGTACCAAGAGGG - Intergenic
1174293004 20:49522136-49522158 CAGCTGAAGCAGAGTGAGGGAGG - Intronic
1174584699 20:51599093-51599115 CAGCAGAAGCAGAATGAAGATGG - Exonic
1174831469 20:53816777-53816799 CAGCAAAAGCAGTACTAAGAGGG - Intergenic
1174960501 20:55151686-55151708 CAGCAGTAGGAGGAGGAAGAAGG - Intergenic
1176257297 20:64158946-64158968 CAGGAGAAGCAGGAGGAAGCAGG - Intronic
1176525359 21:7862491-7862513 CAGCAGAGGCAGCTTGAAGAGGG - Intergenic
1177094960 21:16821692-16821714 CATCAGAAGTAACATGAAGAGGG - Intergenic
1177095134 21:16823266-16823288 AAGAAGAAGAAGAAGGAAGAAGG - Intergenic
1177397666 21:20558327-20558349 CTGCATAACCAGAATGGAGATGG - Intergenic
1177613206 21:23481514-23481536 CAGCAGAAGAAAAAGGAATAAGG + Intergenic
1177861859 21:26463719-26463741 CAACAGGAGCAGAATGGAGCTGG - Intergenic
1178659379 21:34492504-34492526 CAGCAGAGGCAGCTTGAAGAGGG - Intergenic
1178928700 21:36797689-36797711 CAGCAGAAGAAAAATTGAGAAGG + Intronic
1179081848 21:38178722-38178744 AAGAAGAAGAAGAAAGAAGAAGG + Intronic
1179257589 21:39730133-39730155 TAGCAGAAGCAGGAAGAAGCAGG - Intergenic
1180124065 21:45775985-45776007 CAGCAAAAGCAGAGCTAAGAGGG - Intronic
1180192557 21:46173046-46173068 CAGCTGAAGCAGAACCCAGAGGG + Intronic
1180607715 22:17072701-17072723 CAGCAGAAGCAGTAACAAGAGGG - Intergenic
1180863897 22:19104887-19104909 CAGCAGCAGCAGAGGGGAGAAGG + Intronic
1180885287 22:19239177-19239199 CAGCAGAAGCAGACTAAAAATGG + Intronic
1181110638 22:20600772-20600794 GAGCAGAAGCAAAATGCAGTTGG - Intergenic
1181143902 22:20829801-20829823 CAGCTAAGGCAGAATTAAGAGGG - Intronic
1181385637 22:22543548-22543570 CAGCAAAAGCAAATTAAAGAAGG + Intergenic
1182609749 22:31537294-31537316 AGGCAGAAGCAGAATGCAGTGGG - Intronic
1182910190 22:33977587-33977609 AAAGTGAAGCAGAATGAAGATGG - Intergenic
1182953778 22:34401896-34401918 CAGCAGAAGGATACTGATGAGGG - Intergenic
1183044739 22:35210816-35210838 CTACAGAAGCAGAAGGAAAATGG + Intergenic
1183723707 22:39576869-39576891 GAGCAGAAGCAGACAGAAGTCGG - Intronic
1183758749 22:39796205-39796227 CAGCAAAAGCAGTAGTAAGAGGG - Intronic
1183981848 22:41545246-41545268 CGGAAGAAGAAGAAAGAAGAAGG + Intergenic
1184185662 22:42863330-42863352 AAGAAGAAGAAGAAAGAAGAAGG + Intronic
1184327830 22:43804313-43804335 CAGCAAAAGCAGTACTAAGAAGG + Intronic
1184821064 22:46909636-46909658 CAGCAGCAACAGAAGGAAGAAGG - Intronic
1184989879 22:48160183-48160205 AAGAAGAAGAAGAAAGAAGAAGG + Intergenic
1185121407 22:48973814-48973836 CAGCAGGAGCAGAGTGGGGACGG + Intergenic
949330221 3:2914146-2914168 CAGCAAAAGCAGTAATAAGAGGG + Intronic
949347769 3:3092782-3092804 CAGTAGAAGGAAAAAGAAGAAGG - Intronic
950187986 3:10957235-10957257 CAGCAGATGCAGAAGCAGGAGGG + Intergenic
950217809 3:11171835-11171857 CATCTGAAGCAGGATGAAGTAGG + Intronic
950675998 3:14554814-14554836 CTGCACAATCAGAATGAGGATGG + Intergenic
950760016 3:15214218-15214240 CAACAAAAGCAGAAAGAAGTTGG - Intronic
950992394 3:17453155-17453177 CAGCAAAAGCAGTAGTAAGAGGG + Intronic
950995567 3:17492744-17492766 CAGCTGAAGCAGTGTTAAGATGG - Intronic
951101021 3:18688813-18688835 CAGCAAAAGCAGCATTTAGAGGG - Intergenic
951164145 3:19464566-19464588 CAGCAGTAACAGAATAAAAAGGG + Intronic
952132358 3:30380021-30380043 CAGCAAAAGCAGTACTAAGAGGG - Intergenic
952188964 3:31001800-31001822 CAGCAGAAGCAGGAACAACAGGG + Intergenic
952683831 3:36126808-36126830 CAGCAAAAGCAGTATTATGAGGG + Intergenic
952694862 3:36252904-36252926 CAGCTAAAGCAGAGTTAAGAGGG + Intergenic
953121169 3:40044057-40044079 AAGCAGAAGCTGGATGAGGAAGG + Exonic
953215183 3:40911441-40911463 CAGCAGAAAGAGAATAAAGCTGG - Intergenic
953371496 3:42392365-42392387 CAGCTAAAGGTGAATGAAGAAGG + Intergenic
954033733 3:47838834-47838856 CAGCAGAAGAGAAATGCAGATGG - Intronic
954256758 3:49412536-49412558 CAGCAGCAGCAGCTTGAAGAGGG - Exonic
954949416 3:54457208-54457230 CAGCAAAGGCAGTATTAAGAGGG - Intronic
955307393 3:57848145-57848167 GAGGAGAAGAAGAAGGAAGAAGG - Intronic
955472122 3:59296754-59296776 CAGCCAAAGCAGTGTGAAGAGGG + Intergenic
955506294 3:59636358-59636380 CAGCAGATGCAGATTCCAGATGG + Intergenic
955819557 3:62881715-62881737 CAGCAGAGGCAGAAGCAGGAAGG - Intergenic
955831843 3:63013208-63013230 CAGCTAAAGCAGTATTAAGAGGG - Intergenic
956226218 3:66961999-66962021 CAGCCCAAGCAGAATGGGGAGGG - Intergenic
956516368 3:70052920-70052942 CAAGAGAAGCAGAAAGAAAAGGG - Intergenic
956784427 3:72630576-72630598 GGGGAGAAGCAGAAGGAAGAAGG + Intergenic
956867610 3:73384911-73384933 CAGAAGAAGCACGACGAAGACGG - Exonic
957464000 3:80561763-80561785 CAGCAAAATCAGCATTAAGAGGG + Intergenic
957757029 3:84503484-84503506 AAGAAGAAGCAGAGTGAAGGTGG - Intergenic
958098369 3:88976225-88976247 CAGCAAAAGCAGTACCAAGAGGG + Intergenic
958631929 3:96696190-96696212 CAGCAAAAGCAGTATTCAGAGGG - Intergenic
959479680 3:106856043-106856065 CAGCTAAAGCAGTATTAAGAAGG + Intergenic
959717424 3:109448299-109448321 CAGCAAAAGCAGTACTAAGAGGG + Intergenic
959766297 3:110033574-110033596 CAGCAAAAGCAGTACTAAGAGGG - Intergenic
959877579 3:111403194-111403216 CAGCAAAAGCAGAATTAAAAGGG - Intronic
959920741 3:111865632-111865654 TAGCAGAACCAGAACTAAGATGG + Intronic
960060532 3:113316287-113316309 CAGCCAAAGCAGAGTTAAGAGGG + Intronic
960214389 3:115013057-115013079 CAGCAAAAGCAGTACTAAGAGGG + Intronic
960982734 3:123246430-123246452 GAGCAGTGGAAGAATGAAGAGGG + Intronic
961151084 3:124638526-124638548 CAGCATTTGTAGAATGAAGAGGG - Intronic
961912568 3:130334914-130334936 CAGCAAAAGCAGTACTAAGAGGG + Intergenic
962276377 3:134017758-134017780 GAGAAGAGGGAGAATGAAGAGGG + Intronic
962379496 3:134886136-134886158 CAGCAGAAGCAGGAGGATGTGGG + Intronic
962542001 3:136391729-136391751 CAGAAGGAGCTGAAGGAAGAAGG + Intronic
962808430 3:138943065-138943087 CGGCAGGAGCAGGATGGAGAGGG - Intergenic
963333193 3:143939326-143939348 CAGCAAAAGCAGCACCAAGAAGG + Intergenic
963365384 3:144327263-144327285 CAGCAGAAGTAGTACTAAGAGGG + Intergenic
963422531 3:145078324-145078346 CACCAGAAGCTGAAGGAACAAGG - Intergenic
963538633 3:146559956-146559978 CAGCACAACCAGAATAAAGCAGG - Intergenic
963818944 3:149866686-149866708 CAGCAAAAGCAGTATTAAGAGGG - Intronic
963900211 3:150726406-150726428 CAGGAGAAGCAGACTGAATGTGG + Intergenic
964081590 3:152765253-152765275 CAGCTAAAGCAGTATTAAGAGGG + Intergenic
964322570 3:155513532-155513554 GACAAGAAGCAGAATCAAGATGG + Intronic
964429044 3:156584736-156584758 CAGCAAAAGCATAAAGAACAAGG + Intergenic
964546831 3:157843566-157843588 CAGCAGCAGCAAAATGAGCAAGG + Intergenic
964561097 3:157997421-157997443 AAGTAGAAGCAGAAGGCAGAAGG - Intergenic
964901723 3:161668005-161668027 CAGCAAAAGCAGTGTTAAGAGGG - Intergenic
965047762 3:163600856-163600878 CAGCAAAAGCAGTACTAAGAGGG + Intergenic
965158031 3:165089524-165089546 GAGCAGGAGCAGAGAGAAGAAGG + Intergenic
965236626 3:166133041-166133063 CAGCAAAAGCAGTACTAAGAGGG - Intergenic
965380771 3:167984886-167984908 CAGCAAAAGCAGTACTAAGAGGG + Intergenic
965551147 3:169966634-169966656 CAGCAGGAGCGGAGGGAAGAGGG + Intronic
965621645 3:170648292-170648314 CAGCTGAAGCAGCATTAAGAGGG - Intronic
966666135 3:182472993-182473015 TAGAAGAAGAAGACTGAAGAGGG - Intergenic
966921872 3:184617473-184617495 CAGCAGCAGCAGCAGCAAGATGG + Intronic
967551687 3:190802352-190802374 CAGCAAAAGCAGTACTAAGAAGG + Intergenic
968253232 3:197242760-197242782 CAGCAAAAGCAGTATTAAGCAGG + Intronic
968376544 4:47593-47615 AAGAAGAAGAAGAAAGAAGAAGG + Intergenic
968846120 4:3042439-3042461 CCTCAGCTGCAGAATGAAGATGG + Intergenic
969104442 4:4794622-4794644 CAGAAGAAGCAGGATGGAGAGGG - Intergenic
969320820 4:6411396-6411418 CAGCAGGAGCAGCAGGAAGGAGG + Intronic
969448770 4:7260830-7260852 GAGCAGCAGCAGGAGGAAGAGGG - Intronic
969560771 4:7946397-7946419 AAGCAGGAGCAGAAGGATGAGGG + Intergenic
969726961 4:8925389-8925411 CAGCAAAAGCAGTACCAAGAGGG + Intergenic
970166861 4:13247755-13247777 AAGTAGAAGGAGAAAGAAGATGG - Intergenic
970276016 4:14402155-14402177 CTGCTGAAGCAGAAGGAAAAGGG + Intergenic
970475670 4:16420246-16420268 CAGCAAAAGCAGCACTAAGAGGG - Intergenic
970592562 4:17572212-17572234 CAGCAGCAGCAGCAGCAAGATGG - Intergenic
971094682 4:23387374-23387396 AAGGAGAAGCAGAAGTAAGATGG - Intergenic
971222217 4:24718734-24718756 CAGTTGAAGCAGAAGCAAGAGGG + Intergenic
971507879 4:27386257-27386279 TAGCTGAAGCAGAGTGAATAGGG - Intergenic
972009697 4:34161772-34161794 CAGCAAAAGCAGTGTTAAGAGGG + Intergenic
972236860 4:37145341-37145363 CAGCAAAAGCAGTACCAAGAGGG - Intergenic
972373930 4:38452705-38452727 CAGCAGAAGAAGAAAGAATATGG + Intergenic
973327120 4:48874213-48874235 CAGCAAAAGCAGCACTAAGAGGG - Intergenic
973763624 4:54143673-54143695 CAGCAAAAGCAGTACTAAGAGGG + Intronic
973911515 4:55586112-55586134 CAGCAGAAGCAGATTTAAGAGGG - Intronic
974180947 4:58384107-58384129 CAGCTAAAGCAGTATTAAGAGGG - Intergenic
975035475 4:69674759-69674781 CAGCAAAAGCAGCATTAAGTAGG - Intergenic
975304216 4:72830273-72830295 CAGCCAAGGCAGAATTAAGAGGG + Intergenic
975308004 4:72870862-72870884 CAGCAAAAGCAGTGTGCAGAGGG + Intergenic
975859909 4:78665760-78665782 CAGATGAAGCAGAAAGAAAAAGG - Intergenic
976041366 4:80888963-80888985 CAGCAAAAGCAGTATTCAGAGGG + Intronic
976102789 4:81583216-81583238 CAGCAGAAGCATAATACAGTTGG + Intronic
976253921 4:83081433-83081455 CAGCAAAAGCAGTACTAAGAGGG - Intergenic
976310858 4:83611734-83611756 CAGCAAAAGCAGTATTAAGAGGG - Intergenic
977277084 4:94991164-94991186 CAGTAGAAGGAGAATGAAAAAGG - Intronic
977285303 4:95098649-95098671 AAGCAGCAGCAGAATGAACCTGG - Intronic
977468114 4:97407379-97407401 AAGCAGTAGGAGAAAGAAGAAGG - Intronic
977515262 4:98014121-98014143 CAGCTAAAGCAGTATTAAGAGGG - Intronic
977805639 4:101294135-101294157 CAGAAGAAGTGGAATGGAGATGG + Intronic
977855016 4:101878942-101878964 CAGCAAAAGCAGTACTAAGAGGG + Intronic
978010169 4:103671781-103671803 CAGCAAAAGCAGGACTAAGAGGG - Intronic
978059030 4:104312925-104312947 CAGAAAAAGCAGAACTAAGAGGG + Intergenic
978117420 4:105037594-105037616 CAGCAAAAGCAGTACTAAGAGGG + Intergenic
978137941 4:105285837-105285859 CAGCAAAAGCAGTACTAAGAGGG - Intergenic
978247738 4:106595292-106595314 CAGAAGAAGCAGAGTGAATAGGG - Intergenic
978415833 4:108474915-108474937 GAGCAGAAGCAAGAGGAAGAGGG - Intergenic
978456366 4:108896984-108897006 GAGCAGAGACAGAATTAAGAAGG - Intronic
978718931 4:111882179-111882201 CATCAGAGTCAGAAGGAAGAGGG + Intergenic
978752812 4:112271497-112271519 CAGCAAAAGCAGTATCAGGATGG - Intergenic
978908539 4:114038277-114038299 GAGCACAAGCAAAATGAAGAAGG + Intergenic
978912442 4:114080105-114080127 CAGCAGACTCAGAATGAATGAGG + Intergenic
979288183 4:118950407-118950429 AAGCAGAAGCAGAGAGCAGAAGG + Intronic
979540778 4:121878906-121878928 CAGCAGAGGCAGAAATTAGATGG + Intergenic
979594740 4:122522117-122522139 CAGCAAAAGCAGTACTAAGAGGG - Intergenic
979628250 4:122870974-122870996 CAGCTAAAGCAGTATTAAGAGGG - Intronic
979823112 4:125198633-125198655 CAGCAAAAGAAGAAGGAAGTGGG - Intergenic
979879237 4:125933495-125933517 CAGCAAAGGCAGTATTAAGAAGG + Intergenic
979946191 4:126834247-126834269 CAGCATAAGCAGTACTAAGAGGG + Intergenic
980176867 4:129356460-129356482 CATCAGAAGGAGAAAGAGGAGGG - Intergenic
980331527 4:131416346-131416368 CAGCCGAGGCAGCATTAAGAGGG + Intergenic
980381490 4:132025524-132025546 CAACTCAAGCAGAGTGAAGACGG + Intergenic
980477131 4:133332701-133332723 CAGCTAAAGCAGTATTAAGAGGG - Intergenic
980489668 4:133508515-133508537 CAGCTAAAGCAGTATTAAGAGGG + Intergenic
980576134 4:134685286-134685308 CAGCTGAAGCAGTATGGAGAGGG - Intergenic
980663034 4:135891981-135892003 CAGCAGAAAATTAATGAAGATGG - Intergenic
981517962 4:145630801-145630823 CAGCAAAAGCAGTACTAAGAGGG - Intronic
981556983 4:146005985-146006007 CAACAGAAGCAGTACTAAGAAGG - Intergenic
981611699 4:146600138-146600160 CAACAGAACCACAATGATGAAGG - Intergenic
981640070 4:146931975-146931997 AAGAAAAAGCAGAAAGAAGAAGG - Intronic
981792107 4:148549860-148549882 CAGCACGTACAGAATGAAGAAGG - Intergenic
982076788 4:151745692-151745714 CAGAATAAGGGGAATGAAGAGGG - Intronic
982092208 4:151890211-151890233 CAGCTGGAGGAGTATGAAGAAGG - Intergenic
982204794 4:152989671-152989693 CAGCAGAAGAAGGAAGAACAGGG + Intergenic
982628782 4:157804526-157804548 CAGCTGAAGAAGAATAAAGCTGG - Intergenic
982872137 4:160593764-160593786 TAGCTGAAACAGAAAGAAGACGG + Intergenic
982934760 4:161458641-161458663 AAGCAGAAACAGAAAGAAAATGG - Intronic
983033332 4:162830737-162830759 AAGCATTAGCAGAATGAAAATGG + Intergenic
983165676 4:164474399-164474421 CAGCAGAAGCAGTACCAAGAGGG - Intergenic
983238646 4:165207490-165207512 CAGCAGCAGCAGCAGGAGGAAGG + Intronic
983380413 4:166984628-166984650 CAGCAGAAACTGAATAAACAGGG + Intronic
983426715 4:167593458-167593480 AAGAAGAAGAAGAAAGAAGAAGG + Intergenic
983594992 4:169456206-169456228 CAGCAAAAGCAGTACTAAGACGG + Intronic
983877560 4:172894348-172894370 CAGCAAAAGCAGTACTAAGAGGG - Intronic
983972103 4:173888209-173888231 CAGCTAAAGCAGTATTAAGAGGG - Intergenic
984235864 4:177157905-177157927 CAGCAAAAGCAGTACTAAGAAGG + Intergenic
984443711 4:179806218-179806240 CAGTATAAGCAGAACTAAGAGGG + Intergenic
984473863 4:180213045-180213067 CAGCAGCAGCAGAATAAAAGAGG - Intergenic
984535741 4:180973157-180973179 AAGCAGAAGCTAAGTGAAGAGGG + Intergenic
984836190 4:184023939-184023961 CAGCTGAAGGAGAATAAACATGG - Intergenic
985161478 4:187048857-187048879 CAGGAGAAGGGGAATGAAGGTGG + Intergenic
985345049 4:188995512-188995534 GAGCAGAAGCAGAAGGACAAAGG + Intergenic
985482474 5:124003-124025 CAGCAAAAGCAGCATTAAGGGGG - Intergenic
986113474 5:4745330-4745352 TAGCAAAAGCAGTATTAAGAGGG - Intergenic
986280094 5:6315700-6315722 CAGCAGGAGCAGGAGGAAGGTGG - Intergenic
986350796 5:6877947-6877969 CTACAGAAGAAGAAGGAAGAGGG - Intergenic
986709049 5:10474383-10474405 CAGCAGTAGCAGACTAGAGAGGG + Intergenic
986884965 5:12222818-12222840 CAGCAAAAGCAGTACGAAGTGGG - Intergenic
986907310 5:12510778-12510800 CAGCTAAAGCAGTATTAAGAGGG - Intergenic
987209780 5:15669011-15669033 CAGCAGCAGCAGAAACAATAAGG - Intronic
987262580 5:16218685-16218707 CAACCGAAGCAGAAAGAAAAGGG + Intergenic
987354666 5:17052762-17052784 AACCAGAAGAAGAAAGAAGAAGG - Intergenic
987496318 5:18649648-18649670 CAGCAAAAGCAGTACTAAGAAGG - Intergenic
988021784 5:25630224-25630246 CAGCTAAAGCAGTATTAAGAGGG + Intergenic
988091681 5:26549600-26549622 CAGCAAAAGCAGTACTAAGAGGG + Intergenic
988688381 5:33547966-33547988 CAGGGGAAGGAGGATGAAGAGGG + Intronic
988955967 5:36319760-36319782 CAGCAAAAGCAGTACTAAGAGGG - Intergenic
988985122 5:36610858-36610880 AGGCAGAAGCAGCAAGAAGAAGG + Intronic
989215179 5:38897767-38897789 CAGCAAAAGCAGTACTAAGAAGG - Intronic
989428111 5:41319601-41319623 CAGCAAAAGCAGTACTAAGAAGG + Intronic
989609015 5:43273662-43273684 CTGGAAAAGCAGAATGAGGAGGG - Intronic
990004142 5:50924777-50924799 CAGCAAAAGCAGATCTAAGAAGG + Intergenic
990123430 5:52484364-52484386 AAGAAGAAGGAGAATGAGGAGGG + Intergenic
990131078 5:52584702-52584724 TAGCAAAAGCAGAAAGAAAAAGG + Intergenic
990334411 5:54757894-54757916 GAGCAGAAGCAGAGCAAAGATGG + Intergenic
990825520 5:59893682-59893704 CAGCAGCAGCAGCATCAGGAAGG - Exonic
991394913 5:66194779-66194801 CAGCAAAAGCAGTACTAAGAAGG - Intergenic
991506727 5:67332614-67332636 CAGCAAAAGCAGCTTCAAGAGGG - Intergenic
991508169 5:67347021-67347043 CAGCAAAAGTAGTTTGAAGAGGG + Intergenic
991681496 5:69144512-69144534 CAGCAAAAGCAGTACTAAGAGGG - Intergenic
992015537 5:72572009-72572031 GAGCAGAAGCAGATGGCAGATGG - Intergenic
992197830 5:74357259-74357281 CCTCAGAAGCAGAGTGAGGAGGG - Intergenic
992692240 5:79252116-79252138 CAGCAAAAGCAGTACCAAGAGGG - Intronic
993897586 5:93556109-93556131 CTACAGAAGCAGAAAGAACATGG - Intergenic
993899742 5:93577146-93577168 CAGGAGAAGCAGCAGGAGGAAGG - Intergenic
994038550 5:95230452-95230474 AAGCAGAATGAGAATAAAGATGG - Intronic
994039159 5:95238057-95238079 TAGCAGAAGCAGCATGAAATCGG + Intronic
994456160 5:100010787-100010809 CATCAGAAACAGAATAGAGAAGG + Intergenic
994860011 5:105180012-105180034 CAGCATGAGCAAAATAAAGATGG - Intergenic
995035147 5:107525709-107525731 GAGGAGAAGGAGAAAGAAGAGGG + Intronic
995171737 5:109122219-109122241 CAGCAAAAGCAGTACTAAGAGGG - Intronic
995271961 5:110230586-110230608 CAGCAAAAGCAGTATTAAGAAGG + Intergenic
995306688 5:110659304-110659326 CAGCAGAAAAAGAATGAGAATGG + Intronic
995695384 5:114873309-114873331 CAGCTGAAGCAGAAGGAATGGGG - Intergenic
995918705 5:117284142-117284164 CAGGAGAAGCAGATTGAACACGG - Intergenic
996085745 5:119303372-119303394 CAGCAGAGGGAGAAGGAAGGAGG - Intronic
996284466 5:121771924-121771946 CACCAGAAACTGAAGGAAGAGGG - Intergenic
996459814 5:123728700-123728722 CAGCAAAAGCAGTACTAAGAGGG + Intergenic
998588312 5:143451306-143451328 CAACAGAAGAAGAATAAAAAGGG - Intergenic
998781707 5:145664365-145664387 ACTAAGAAGCAGAATGAAGAAGG + Intronic
999072214 5:148756747-148756769 CAGCAAAAGCAGTACTAAGAGGG - Intergenic
999349348 5:150853096-150853118 CTGTAAAAGCAGTATGAAGAGGG - Intronic
999444673 5:151629846-151629868 AAGAAGAAGAAGAAAGAAGAAGG + Intergenic
999640468 5:153667300-153667322 CAGCACAGGCAGGATGATGAGGG + Intronic
1000010112 5:157223132-157223154 GAGCAGAGGCAGAAGGAAGAGGG + Intronic
1000060780 5:157653105-157653127 CAGTAGAAAGAGAATGATGATGG - Intronic
1000065786 5:157691934-157691956 CAGTAGAAAGAGAATGATGATGG - Intergenic
1000158967 5:158581673-158581695 GAGCAAAAGCAGTATTAAGAGGG - Intergenic
1001313641 5:170628022-170628044 AAGCAGGAGCAGAAGGAAGAGGG - Intronic
1001737807 5:174021114-174021136 AAGAAGAAGGAGAAGGAAGAAGG + Intergenic
1002093640 5:176818376-176818398 TAGCAGAAGGAGAATGAATTTGG - Intronic
1002352440 5:178592412-178592434 GAGCAGAGGCAGAAGGAAGAAGG + Intergenic
1002551683 5:179998232-179998254 CAGCAAAAGCAGTTTGAAGAAGG - Intronic
1002952475 6:1828340-1828362 CAGAAGAAGCAGAGAGAAGAAGG + Intronic
1002969125 6:1996093-1996115 AAGGAGAAGGAGAAGGAAGAAGG - Intronic
1003096990 6:3149957-3149979 TAGAAGAAGCAGAATGAAAAAGG + Intronic
1003127347 6:3365823-3365845 CAGCAGCAGCAGAAGGAAAAAGG + Intronic
1003686804 6:8312452-8312474 CAGCTAAAGCAGTATTAAGAGGG - Intergenic
1003775481 6:9356946-9356968 CAGCAAAAGCAGTACTAAGAGGG + Intergenic
1004076726 6:12350689-12350711 CAGGAGGAAGAGAATGAAGAGGG + Intergenic
1004118134 6:12791195-12791217 CTGCAGAAGGAGAAGGAAGCAGG + Intronic
1004764245 6:18707553-18707575 CAGCAAAAGCAGTGTGAATAGGG - Intergenic
1005364889 6:25066931-25066953 CAGCAGATACAGGATGGAGAGGG + Intergenic
1006152756 6:31998079-31998101 CAAGAGACACAGAATGAAGAAGG - Intronic
1006159064 6:32030816-32030838 CAAGAGACACAGAATGAAGAAGG - Intronic
1006462328 6:34168694-34168716 CAGCAAAAGCAGTACTAAGAGGG - Intergenic
1006622291 6:35374227-35374249 CAGCAGGAGCAGAACTTAGATGG + Intronic
1006881096 6:37340868-37340890 CAGCAGCAGCAGAAGGCAGTGGG - Intergenic
1007126500 6:39430150-39430172 GAGAAGAAGCATAAAGAAGAGGG - Intronic
1007190891 6:40017308-40017330 CAGCAGAAGCAGTGCTAAGAGGG - Intergenic
1007367714 6:41406635-41406657 AAGCAGAAGCAGAAGGAGGTTGG + Intergenic
1007814601 6:44512443-44512465 CAGAAAAGACAGAATGAAGAAGG + Intergenic
1008384363 6:50871510-50871532 AAGCAAAACCAAAATGAAGATGG - Intergenic
1008664336 6:53701243-53701265 TAGCAGAAGCAGAAGCATGAAGG - Intergenic
1008705775 6:54157353-54157375 CTGCAGGAGCAGAGTGAAGAGGG - Intronic
1008798589 6:55338719-55338741 CAGAAGAAACAGAATGAAGTGGG + Intronic
1008882125 6:56391290-56391312 CAGCAAAAGCAGTACCAAGAGGG + Intronic
1008938836 6:57022781-57022803 CAGCAGAAGCAGTACTGAGATGG - Intronic
1008941842 6:57055895-57055917 CAGCAGATGCAAAATGAATTGGG + Intergenic
1008999454 6:57696759-57696781 AAGAAGAAGAAGAAGGAAGAAGG - Intergenic
1009245727 6:61234957-61234979 CAGCAAAAGCAGTACTAAGAGGG + Intergenic
1009289205 6:61863440-61863462 CAGCAAAAGCAGTGTTAAGAAGG - Intronic
1009748385 6:67850015-67850037 CAGCAAAAGCAGTACTAAGAGGG + Intergenic
1009789398 6:68382049-68382071 CAGCAAAAGCAGAACTAAGAGGG - Intergenic
1009961464 6:70527764-70527786 AAGAAGGAGCAGAACGAAGAGGG - Intronic
1009997543 6:70913312-70913334 CAGCTAAAGCAGTATTAAGAGGG - Intronic
1010276691 6:73976174-73976196 CAGCTAAAGCAGTATGAAGAGGG - Intergenic
1010299224 6:74240376-74240398 CAGCAAAAGCAGTACTAAGAGGG - Intergenic
1010485669 6:76410457-76410479 AAGAAGAAGAAGAAGGAAGAAGG - Intergenic
1010529177 6:76945479-76945501 CAGCAAAAGCAGTACTAAGAGGG + Intergenic
1011159919 6:84378085-84378107 CAGCAAAAGCAGTATTAAGAGGG - Intergenic
1011232297 6:85176294-85176316 CAGCAAAAGCAGTATTAAGAGGG - Intergenic
1011290799 6:85774851-85774873 CAGCAAAAGCAGCACCAAGAGGG - Intergenic
1011758553 6:90532083-90532105 AAGGAGGTGCAGAATGAAGATGG + Intronic
1011854299 6:91669601-91669623 CAGGAGGAGCAGAAAGAAGAGGG - Intergenic
1011901677 6:92305929-92305951 CAGCAAAAGCAGTACTAAGATGG + Intergenic
1011942468 6:92858865-92858887 CACCAGAAGCAGAACAGAGAGGG + Intergenic
1012231980 6:96770764-96770786 CAGCAAAAGCAGTGTTAAGAGGG + Intergenic
1012288125 6:97418496-97418518 CAGCAAAAGCAGTACTAAGAGGG - Intergenic
1013226839 6:108125290-108125312 CAGCAGAGGCAGAAGGCAGCAGG - Intronic
1014040944 6:116824092-116824114 CAGCAAAAGCAGTACTAAGAAGG + Intronic
1014122240 6:117738782-117738804 CAACAGAAGCAGCACTAAGATGG - Intergenic
1014429500 6:121350831-121350853 CTACATAAGCAGAATGAAGAGGG + Intergenic
1014552617 6:122806660-122806682 CTGGAGAAGAAGAATGAACATGG - Intronic
1015452642 6:133388929-133388951 GAGCAGAAGCAGAAGGACGTGGG - Intronic
1015585591 6:134772824-134772846 TAGCAAAAGCAGAAGCAAGATGG - Intergenic
1016340866 6:143060632-143060654 ACGCAGGAGCAGAATGACGAAGG + Intronic
1016728707 6:147405279-147405301 CAGCAAAAGCAGTATGGAGAGGG - Intergenic
1017003880 6:150015460-150015482 CATCAGAAGAAGAATGCAAATGG - Intergenic
1017293335 6:152766203-152766225 CAGCAGTAGGAGAAAGATGAAGG + Intergenic
1017549597 6:155491950-155491972 CAGCAGAAGCAGAAGAAACAAGG - Intergenic
1018051818 6:160015895-160015917 CAGCAAAAGCAGGAGCAAGACGG - Intronic
1018345441 6:162894044-162894066 CAGCAAAACCAGAATGAAAAAGG - Intronic
1018550768 6:164996138-164996160 CAGCAAAAACATAAGGAAGAGGG + Intergenic
1018788267 6:167125683-167125705 AAGCAGAACCAGAAGAAAGAGGG - Intronic
1019030670 6:169008140-169008162 AAGCAGAGGCAGAACGAAGCAGG + Intergenic
1019363744 7:619756-619778 AAACAGAAGCACAAAGAAGAGGG - Intronic
1019486898 7:1293555-1293577 CAGGAGAAGCAACGTGAAGAGGG - Intergenic
1019797636 7:3063525-3063547 GAGGAGAAGCAGAAGAAAGAAGG - Intergenic
1020422829 7:8028452-8028474 CAGCAAAAGCAGCACTAAGAGGG + Intronic
1020507514 7:9011394-9011416 CAGCAAAAACAGAACTAAGAGGG - Intergenic
1020518996 7:9162867-9162889 CAGCAAAAGCAGTACTAAGAGGG - Intergenic
1020577346 7:9949887-9949909 AAGAAGAAGAAGAAGGAAGAGGG + Intergenic
1020641516 7:10759800-10759822 TAGCAGAAACAGTATGAACATGG - Intergenic
1020828136 7:13058019-13058041 GAGGAGAAGCAGAAAGAAGGAGG - Intergenic
1020940833 7:14535025-14535047 CAGCAAAAGCAGTATGAAGAGGG + Intronic
1021191757 7:17628507-17628529 CAGGAGAAGCAAATTGAAAATGG + Intergenic
1022223310 7:28336843-28336865 CAGCAAAAGCAGTACTAAGAGGG - Intronic
1022366678 7:29727549-29727571 CAGCGAAAGCAGTATTAAGAGGG - Intergenic
1022686115 7:32598284-32598306 CAGCTAAAGCAGTATTAAGAGGG + Intergenic
1022740845 7:33119815-33119837 CAGCAAAAGCAGTACTAAGAGGG - Intergenic
1023097155 7:36672976-36672998 AAGCAGAAGAAGGATGAACACGG + Intronic
1023214496 7:37847531-37847553 AAGAAGAAGGAGAAAGAAGAAGG + Intronic
1023468506 7:40486617-40486639 CAGCAAAAGCAGTACTAAGAGGG - Intronic
1023643719 7:42287629-42287651 CAGAAGAGGGAGAATAAAGATGG - Intergenic
1023835712 7:44066086-44066108 CAGCAGCAGCAGAATGGGCAAGG + Intronic
1023930955 7:44706285-44706307 CAGCAGAAACAGAGTAAACATGG + Intronic
1024059124 7:45685353-45685375 CAGCAGTAACAGGATGAAGCTGG + Intronic
1024106477 7:46093000-46093022 CAGCTGAAGCAGTGTTAAGAGGG - Intergenic
1024130130 7:46343052-46343074 CTGCTGAAGAAGAATGAGGAAGG - Intergenic
1024316196 7:48019288-48019310 CAGCAAAAGCAGTACTAAGAGGG + Intronic
1024583228 7:50817997-50818019 CAGCAGAATCACAGTAAAGATGG - Intergenic
1024597377 7:50950567-50950589 CAATAGAAGCAGTATTAAGAGGG + Intergenic
1024881871 7:54096117-54096139 CAGCAGCAAGAGAATTAAGAAGG - Intergenic
1025003672 7:55339161-55339183 CAGAAGGAGTAGAATGAGGAAGG + Intergenic
1026886306 7:73949414-73949436 CAGGAGAAGAAGAAAGCAGAAGG - Intergenic
1027996421 7:85430806-85430828 CAGCAAAAGCAGTACTAAGAGGG + Intergenic
1028119222 7:87038779-87038801 CAACAAAAGCAGTATTAAGAGGG + Intronic
1028304804 7:89249626-89249648 CAGCAAAAGCAGTATTAAGAGGG + Intronic
1028560616 7:92171037-92171059 CAGCAAAAGCAGTATTAAGAGGG + Intronic
1028753525 7:94409478-94409500 GGGAAGAAGAAGAATGAAGATGG + Intronic
1029825602 7:103189994-103190016 CAGCGAAAGCAGTATTAAGAGGG + Intergenic
1030160360 7:106502159-106502181 CTGCAGAAGCAGAGTCAGGAGGG - Intergenic
1030209379 7:106981246-106981268 CAGCAAAAGCAGGAGCAAGAGGG - Intergenic
1030599343 7:111575269-111575291 CAGCAAAAGCAGTACTAAGAGGG + Intergenic
1030747974 7:113191371-113191393 CAGCAAAAGCAGTACTAAGAGGG + Intergenic
1030919031 7:115356861-115356883 CAGGAGAAGCAGAAGCAAGTTGG + Intergenic
1031098781 7:117452310-117452332 CAGCAAAAGCAGTACTAAGAGGG + Intergenic
1031280381 7:119792665-119792687 CAGCAAAAGCAGTACTAAGAGGG - Intergenic
1031618574 7:123908916-123908938 AAGAAGAAGAAGAAGGAAGAAGG + Intergenic
1031790686 7:126099344-126099366 AAGTAGAAGAAGAATTAAGAAGG - Intergenic
1031804860 7:126295330-126295352 CAGCAAAAGCAGTGTTAAGAGGG + Intergenic
1031863845 7:127015094-127015116 AAGGAGAAGGAGAAGGAAGAAGG + Intronic
1031863849 7:127015122-127015144 AAGGAGAAGGAGAAGGAAGAAGG + Intronic
1031915697 7:127560853-127560875 CATAAGAAGCAGGAAGAAGAAGG + Intergenic
1031962279 7:128000854-128000876 GAGCACAAGCAGACTGTAGATGG + Intronic
1032346160 7:131118738-131118760 CAGAAGAAAGAGAATGAAGGGGG + Intronic
1032959527 7:137015501-137015523 CAGCAAGAGCAGGATAAAGAAGG + Exonic
1033291667 7:140090060-140090082 CAACAGCAGCAGTACGAAGAAGG + Exonic
1033465613 7:141586733-141586755 GAGCAGAAGCAGCATCAAGGGGG + Intronic
1033488850 7:141821066-141821088 CAACAGAAGCAGTACTAAGACGG - Intergenic
1033536812 7:142320363-142320385 CCGAAGAGGGAGAATGAAGATGG + Intergenic
1034889519 7:154827677-154827699 CAGCCCAAGCAGAGTGAGGAGGG + Intronic
1035038163 7:155908710-155908732 CAGCAGAGGCCGAATGCAGAGGG + Intergenic
1035050299 7:155994824-155994846 TAGAAGAAGAAGAAGGAAGAAGG - Intergenic
1035139373 7:156742136-156742158 CAGCAAAAGCAGTACTAAGAGGG + Intronic
1035357716 7:158287468-158287490 CAGCAGAAGCAGGTCTAAGAGGG - Intronic
1035419704 7:158717345-158717367 CAGGAGGAGGAGAAGGAAGAAGG - Intergenic
1036661849 8:10714172-10714194 CAGCTGAGGCAGGATGGAGATGG + Intergenic
1037088441 8:14882064-14882086 CAGCAAAAGCAGTGTTAAGAGGG + Intronic
1037230278 8:16650227-16650249 CAGCTAAAGCAGTATTAAGAGGG - Intergenic
1037476494 8:19262875-19262897 TAGAAGATGCAGAATGAAGGAGG - Intergenic
1037921599 8:22810204-22810226 CAGCAGCAGCGGAAGGAAGTAGG - Intronic
1039436608 8:37563856-37563878 CCACAAAAGCAGAAGGAAGAAGG + Intergenic
1039647176 8:39300143-39300165 CAGCAAAAGCAGTACTAAGAGGG - Intergenic
1039674505 8:39646885-39646907 AAGTAGAAGGAGAATGAAGAGGG + Intronic
1039806199 8:41001795-41001817 AAGAAGAAGAAGAAGGAAGAAGG - Intergenic
1039934339 8:42027927-42027949 TAGCAAAAGCAGAGTTAAGAGGG - Intronic
1040021633 8:42746063-42746085 CAGCAGATGCTGAGTGCAGAGGG - Intergenic
1040072226 8:43197875-43197897 CAGGACCAGCAGGATGAAGAAGG - Exonic
1040535962 8:48309875-48309897 CAGCAGAAGCAGTTCTAAGAGGG + Intergenic
1040589251 8:48774236-48774258 CAGCTGAAGCAGGAGGAAGCAGG - Intergenic
1040635868 8:49272062-49272084 CAGCCAAAGCAGAGTTAAGAGGG - Intergenic
1041129745 8:54685306-54685328 CAGCTAAAGCAGTATTAAGAGGG - Intergenic
1041252256 8:55945936-55945958 CAGCGGCAGCAGGATGGAGACGG - Intronic
1041508171 8:58624413-58624435 CAGCAAAAGCAGTATAAACAGGG - Intronic
1041579629 8:59443710-59443732 CAGCAGAAGCAGTACAAAGAGGG - Intergenic
1041741361 8:61160483-61160505 CTGCAGGAGCAGAAGGAAAATGG + Intronic
1042233451 8:66583330-66583352 CAGCAAAAGCAGTATCAAAAGGG + Intronic
1042264598 8:66895372-66895394 AAGAAGAAGAAGAAGGAAGAAGG - Intronic
1042469724 8:69171881-69171903 CAGTAAAAGCAGTGTGAAGAGGG - Intergenic
1042473393 8:69216996-69217018 CAGCTAAAGCAGAGTTAAGAGGG + Intergenic
1043134358 8:76502576-76502598 CAGCAGAAGCATGATGGAAATGG + Intergenic
1043312200 8:78874750-78874772 CAGCAAAAGCAAAGTAAAGAGGG - Intergenic
1043627258 8:82276948-82276970 CAGCAAAAGCAGTACCAAGAGGG + Intergenic
1043627341 8:82278283-82278305 CAGCAAAAGCAGTACTAAGAGGG - Intergenic
1044140794 8:88649082-88649104 AAACAGAAACAGAATGAATAGGG - Intergenic
1044192732 8:89338725-89338747 CAGCAAAAGCAGTACTAAGAGGG - Intergenic
1044458295 8:92414698-92414720 CAGTACATGCAGAATGAATAGGG - Intergenic
1045174313 8:99704983-99705005 TAGCAGAAGTAAAATGTAGAGGG + Intronic
1045698086 8:104833986-104834008 CAGCAGAAGGAGAAGGAACATGG - Intronic
1045784618 8:105905621-105905643 AAACAGAAGCAAAATGAGGAAGG + Intergenic
1046065096 8:109186877-109186899 CAGGAGAGGCAGAATGGAGAGGG - Intergenic
1046119246 8:109824625-109824647 CAGCAAAAGCAGTACTAAGAGGG - Intergenic
1046167620 8:110458189-110458211 AAGAAAAAGCAGCATGAAGAAGG + Intergenic
1046380749 8:113446779-113446801 CAGAAGAAGCCAATTGAAGAAGG - Intergenic
1046574889 8:116015309-116015331 GAGCAGAAGGAGGAAGAAGAGGG - Intergenic
1046739588 8:117814025-117814047 AAGAAGAAGAAGAAAGAAGAAGG + Intronic
1047910407 8:129522032-129522054 TAGCAAAAGCAGTATTAAGAGGG + Intergenic
1047936227 8:129782204-129782226 CAGCAAAAGCAGTACAAAGAGGG + Intronic
1048720997 8:137324877-137324899 CAGCAGAAGCCATATGAACATGG + Intergenic
1049490054 8:142893138-142893160 CAGCAAAAGCAGTACTAAGAGGG - Intronic
1049543017 8:143216981-143217003 CAGCAGAAGGAGGAAGGAGAAGG - Intergenic
1050032051 9:1396371-1396393 CAGCAGAAGCAGTGTTTAGAGGG + Intergenic
1050066311 9:1763473-1763495 CAGCAAAAGCAGACTGCAGAAGG + Intergenic
1050079381 9:1899952-1899974 CAGCAAAAGCAGTGTTAAGAGGG + Intergenic
1050121319 9:2311160-2311182 CAGCAAAAGCAGTACTAAGAGGG - Intergenic
1050183049 9:2941215-2941237 CAGCAGGAGCCAAATGAACATGG + Intergenic
1050239247 9:3617146-3617168 CAGCTAAAGCAGCATTAAGAGGG - Intergenic
1050475917 9:6040967-6040989 GAGAAGAAGAAGAAAGAAGAAGG - Intergenic
1050914268 9:11111579-11111601 CAGCAAAAGCAGTACTAAGAGGG + Intergenic
1050951762 9:11605358-11605380 AAGCAGAAGCAGAGATAAGATGG - Intergenic
1051111035 9:13637004-13637026 CATCAGAAGCAGACTTCAGAGGG + Intergenic
1051149412 9:14064181-14064203 CAGCATAAGAAGAATGAATGGGG + Intergenic
1051283870 9:15474157-15474179 CAGCCTAAGAAGGATGAAGAGGG - Exonic
1051400500 9:16676715-16676737 CCGCAGCAGCGGAATAAAGAAGG + Intronic
1051436143 9:17034516-17034538 CAGCTTAACCAGAATAAAGATGG - Intergenic
1051729920 9:20130545-20130567 TAGCTGAAGCAGAATTAGGAAGG + Intergenic
1051804147 9:20972900-20972922 CAGCAGATGCTGAAAGAAGAGGG - Intronic
1051804156 9:20973002-20973024 CAGCAGATGCTGAAAGAAGAGGG - Intronic
1051804174 9:20973211-20973233 CAGCAGATGCTGAAAGAAGAGGG - Intronic
1051804182 9:20973316-20973338 CAGCAGATGCTGAAAGAAGACGG - Intronic
1051997885 9:23240816-23240838 CAGCAAAAGCAGTACTAAGAGGG + Intergenic
1052025943 9:23573136-23573158 CAGGAGAAAGAGAATGAAGGGGG + Intergenic
1052092080 9:24340948-24340970 GACTAGAAGTAGAATGAAGAAGG - Intergenic
1052176456 9:25469150-25469172 CAGCAAAAGCAGCTTTAAGAGGG - Intergenic
1052495745 9:29221291-29221313 CAGAGGAAGAAGAATGAAGAAGG + Intergenic
1052525010 9:29605963-29605985 TAGCAAAAGCAGTACGAAGAGGG - Intergenic
1052583979 9:30400552-30400574 CAGAAGGAGCAGAGAGAAGAGGG - Intergenic
1052591003 9:30494939-30494961 CAGCAAAAGCAGTATTAAGAGGG + Intergenic
1053454479 9:38222563-38222585 CAGCAAAAGCAGTACAAAGATGG - Intergenic
1055391550 9:75827255-75827277 AAGCAAAAGCAGAATGTGGATGG + Intergenic
1055493088 9:76826143-76826165 CAGCACAAGCAATAGGAAGAAGG + Intronic
1056628860 9:88276153-88276175 CAACAGATGCAGAAAGAAGCTGG + Intergenic
1056697695 9:88873921-88873943 CAGGACAAGGAGAATGAAGCAGG - Intergenic
1056711379 9:88994514-88994536 AAGCAGCAGCAGAATGGAGAAGG + Exonic
1057056371 9:91964465-91964487 CAGAAAAAGCAGAATGGAGGTGG - Intergenic
1057116374 9:92526422-92526444 CAGCAAAAGCAGTACTAAGAGGG + Intronic
1057171164 9:92964024-92964046 CAGCAGAAGCAGGAGGATGGTGG + Intronic
1057444176 9:95102508-95102530 AAGCACAAGCAGTATTAAGAAGG + Intronic
1057641959 9:96833062-96833084 CAGCAGCAGAAGAGAGAAGACGG - Intronic
1057761411 9:97877655-97877677 CTGGAGAAGAAGAAAGAAGATGG + Intergenic
1058144132 9:101392156-101392178 CAGCAGAAGCAGTAGTAAGAGGG + Intronic
1058293139 9:103269727-103269749 CAGCAGAAGAAGCATGATGCTGG + Intergenic
1058505438 9:105661511-105661533 GAGCAGGAACAGAATGATGAAGG - Intergenic
1058509319 9:105699535-105699557 CACCAGAAGCAAAATGATAAAGG + Intronic
1058563025 9:106249755-106249777 CAGCAGAAGAAGGAAGAAGACGG - Intergenic
1058563028 9:106249893-106249915 CAGAAGAAGAAGGAAGAAGAAGG - Intergenic
1058593457 9:106589503-106589525 AAGAAGAAGAAGAATGAGGAGGG + Intergenic
1058768096 9:108202085-108202107 CAGCAAAACCAGTACGAAGAGGG + Intergenic
1059222624 9:112639449-112639471 TAGCCTAAGCAGCATGAAGAAGG - Intronic
1059316252 9:113428185-113428207 CAGCAGCAGCAGATGGAAAAAGG + Exonic
1059436634 9:114281091-114281113 CACCAGATGTAGAATGAAGGAGG - Intronic
1059636077 9:116171883-116171905 AAGCAGAAGCTGATTGAAGAAGG + Intronic
1059695958 9:116730716-116730738 CAGAAGAGGCAGAATGATGCAGG + Intronic
1060351224 9:122862398-122862420 CAGCACAGGCAAAATGAATAAGG - Intronic
1060508386 9:124215095-124215117 CAGCACATGCAGAATCAAGGAGG - Intergenic
1060531585 9:124350099-124350121 CAGCAGCAGCAGCAGGAAGCTGG - Intronic
1062164027 9:135096665-135096687 CAGCAGCTGCAGAATGACAAGGG - Intronic
1203572686 Un_KI270744v1:146580-146602 AAGAAGAAGAAGAAAGAAGAAGG - Intergenic
1185480223 X:440743-440765 CAGCAGCAGCAGCCTGAGGAAGG - Intergenic
1186072904 X:5842106-5842128 AAGCAGAAGCAGAAACAGGAGGG + Intronic
1186774560 X:12851933-12851955 CAGCTAAAGCAGTATTAAGAGGG - Intergenic
1186855707 X:13624164-13624186 CAGCAGCAGGAGAGTGAATATGG - Intronic
1187088867 X:16072523-16072545 CAGCAAAAGCAGTACTAAGAGGG - Intergenic
1187299031 X:18030182-18030204 GATCAGAAGCAGGATTAAGAGGG - Intergenic
1187417902 X:19109045-19109067 AAGAAGAAGAAGAAAGAAGAAGG + Intronic
1187618404 X:21023788-21023810 CAGCAAAAGCAGTACTAAGAGGG - Intergenic
1187644527 X:21332453-21332475 CAGCAAAAGCAGTGTTAAGATGG + Intergenic
1187845215 X:23528457-23528479 CAGCAAAAGCAGTACTAAGAGGG + Intergenic
1187866581 X:23728311-23728333 CAGCTTGAGCACAATGAAGAGGG + Intronic
1187909640 X:24099216-24099238 TAGCTGAAGCAGTATTAAGAGGG - Intergenic
1188045307 X:25419551-25419573 CAGCAAAAGCAGTACTAAGAGGG - Intergenic
1188064115 X:25636455-25636477 CAGCAAAAGCAGTACTAAGAAGG + Intergenic
1188064680 X:25644566-25644588 CAGCAAAAGCAGTACTAAGAGGG - Intergenic
1188068273 X:25687902-25687924 TAGCAAAAACAGAATGGAGAAGG + Intergenic
1188162099 X:26816731-26816753 CAGCAAAAGCAGTATTAAGAGGG - Intergenic
1188168846 X:26895618-26895640 CAGCAAAAGCAGTGTGAAGAGGG + Intergenic
1188223330 X:27566872-27566894 CAGCAAAAGCAGCACTAAGAGGG - Intergenic
1188314824 X:28660065-28660087 AAGCAGAAGCAGAGTGAGGATGG + Intronic
1188915140 X:35901571-35901593 CAGCTAAAGCAGTATTAAGAGGG + Intergenic
1188971951 X:36628659-36628681 CAGCAAAAGCAGTACTAAGAGGG - Intergenic
1188996376 X:36891038-36891060 CAGCAAAAGCAGTACTAAGAGGG + Intergenic
1189119308 X:38377306-38377328 CAGCAAAAGCAGTACTAAGAGGG + Intronic
1189150216 X:38699044-38699066 GAGCATAAGCATAATGAAGGAGG + Intergenic
1189367202 X:40397937-40397959 AATCAGAAGCAGACAGAAGAGGG - Intergenic
1189578194 X:42377657-42377679 CAAGGGAAGCAGAATGAAAAAGG - Intergenic
1189645890 X:43131021-43131043 CAGAAGCAGGAGAAAGAAGAAGG + Intergenic
1189690179 X:43609211-43609233 CAGCAAAAGCAGTATTAAAAGGG - Intergenic
1189867952 X:45351148-45351170 AAGCAGAGCCAGAAAGAAGAAGG - Intergenic
1189907558 X:45777212-45777234 CAGCAGAAGCAGAAAACAAAAGG + Intergenic
1190055389 X:47178466-47178488 GGGCAGATGCAGCATGAAGAGGG - Intronic
1190604817 X:52130103-52130125 CAGCTAAAGCAGTATTAAGAGGG + Intergenic
1190811270 X:53886682-53886704 CAGCAAAAGCAGTACTAAGAGGG - Intergenic
1190899392 X:54654668-54654690 CAGCAAAAGCAGTACTAAGAGGG + Intergenic
1191050912 X:56190808-56190830 CAGCAAAACCAGTATGAAGAAGG + Intergenic
1191067705 X:56367645-56367667 GAGCAGAAGAAGAATCAAAAAGG - Intergenic
1191172432 X:57461641-57461663 CAGCTGAAGCAGTGTTAAGAGGG + Intronic
1191724069 X:64260308-64260330 CAGGAGCAGGAGAGTGAAGAGGG - Intergenic
1191725357 X:64274444-64274466 CAGCAAAGGCAGTATTAAGAAGG + Intronic
1191829844 X:65405183-65405205 CAGCAAAAGCAGTACTAAGAGGG + Intronic
1191919279 X:66237281-66237303 CAGCTAAGGCAGTATGAAGAGGG - Intronic
1192034134 X:67545408-67545430 CAGCAGCAGCAGGGTGAGGATGG + Exonic
1192272041 X:69589907-69589929 AAGAAGAAGAAGAAAGAAGAAGG - Intergenic
1192291330 X:69798657-69798679 CAGCAGAAGCAGTGCCAAGAGGG + Intronic
1192619601 X:72664909-72664931 CAGCAAAAGCAGTACTAAGAAGG + Intronic
1192725606 X:73748698-73748720 CAGCAAAAGCAGTACTAAGAGGG - Intergenic
1192759442 X:74080848-74080870 CAGCAAAAGCAGTACTAAGAAGG - Intergenic
1193065861 X:77259088-77259110 CAGCAAAAGCAGTGTTAAGAGGG + Intergenic
1193102974 X:77636788-77636810 AAGAAGAAGGAGAAGGAAGAAGG + Intronic
1193103000 X:77636897-77636919 AAGAAGAAGAAGAAGGAAGAAGG + Intronic
1193192593 X:78589696-78589718 CAGCAAAAGCAGTAGTAAGAGGG - Intergenic
1193236484 X:79113624-79113646 AAGCAGAAGCAGGCTGAAGGTGG + Intergenic
1193673819 X:84422365-84422387 CAGGAAAAGCAGTATTAAGAGGG + Intronic
1193781414 X:85706726-85706748 CAGCAAAAGCAGTAGTAAGAGGG + Intergenic
1193997804 X:88388130-88388152 TGGCAAAAGCAGAATGAAAAAGG + Intergenic
1194136816 X:90154538-90154560 CAGCAAAAGCAGAACTAAGAGGG + Intergenic
1194252133 X:91588798-91588820 CAGCTAAAGCAGAATTAAGAGGG + Intergenic
1194396260 X:93390437-93390459 CAGCAAAAGCAGTACTAAGAGGG - Intergenic
1194520653 X:94915227-94915249 CAGCAAAAGCAGTAATAAGAGGG + Intergenic
1194534537 X:95089385-95089407 CAGCAAAAGCAGTACTAAGAGGG + Intergenic
1194546649 X:95243163-95243185 CAGCAAAAGCAGTACTAAGAGGG + Intergenic
1194613885 X:96077602-96077624 CAGCAAAAGCAGGACTAAGAGGG + Intergenic
1194689880 X:96970886-96970908 CAGCAAAAGCAGTATTAAAAGGG - Intronic
1194774715 X:97948165-97948187 CAGCAAAAGCAGTACTAAGAGGG - Intergenic
1194857715 X:98955058-98955080 CAGCAAAAGCAGTACTAAGAGGG - Intergenic
1194858158 X:98959977-98959999 CAGAAGAAACAGAAACAAGATGG + Intergenic
1194859940 X:98985600-98985622 CAGGAGAAAGAGAAAGAAGAGGG + Intergenic
1194954530 X:100163166-100163188 CAGCAAAAGCAGTAGGAAGAAGG - Intergenic
1195199779 X:102536951-102536973 CAGCAAAAGCAGTACTAAGAGGG + Intergenic
1195469324 X:105214951-105214973 CAGCTGAAGCAGTGTTAAGAGGG + Intronic
1195482784 X:105366492-105366514 CAGCAAAAGCAGTTTTAAGAGGG - Intronic
1195502808 X:105622222-105622244 CAGTAGAAGCACAATAAATAAGG + Intronic
1195592419 X:106645402-106645424 CAGCAAAAGCAGTAGTAAGAGGG - Intronic
1195662643 X:107395998-107396020 CAGCAAAAGCAGTAGTAAGAGGG - Intergenic
1195758196 X:108220058-108220080 CTGTAGAAGCATAATGGAGAGGG - Intronic
1195848872 X:109261083-109261105 CAGCAAAAGCAGTACTAAGAGGG - Intergenic
1196101722 X:111853858-111853880 CAGGAGAAGCATAAAGAGGAAGG + Exonic
1196233203 X:113249664-113249686 CAGCAAAAGCAGTAGTAAGAGGG - Intergenic
1196333627 X:114502930-114502952 CAGCAAAAGCAGAGCTAAGAGGG + Intergenic
1196895840 X:120334721-120334743 CAGTAGGAGCAGAATGGGGAAGG - Intergenic
1196967495 X:121073837-121073859 CAGCAAAAGCAGTACTAAGAGGG - Intergenic
1197126462 X:122952284-122952306 CAGCAAAAGCAGTACTAAGAGGG - Intergenic
1197129684 X:122990748-122990770 CAGCAGAAGCTCAATGAAAATGG - Intergenic
1197309038 X:124881666-124881688 CAGCAAAAGCAGTGTTAAGAAGG - Intronic
1197360833 X:125501473-125501495 CAGCAAAAGCAGTAGCAAGAGGG - Intergenic
1197440288 X:126479659-126479681 CAGCAAAAGCAGTACTAAGAGGG + Intergenic
1197492248 X:127131910-127131932 CAGCAAAAGCAGTACCAAGAGGG + Intergenic
1197508869 X:127345905-127345927 CAGCAAAAGCAGCACTAAGAGGG - Intergenic
1197645766 X:129015124-129015146 CAGAAGAAGCAGCAAGAAGATGG - Intergenic
1197677939 X:129350692-129350714 CAGCAAAAGCAGTATTAAGAGGG + Intergenic
1198064209 X:133080258-133080280 CAGGAGAATCAGAAGAAAGAAGG + Intronic
1198190777 X:134302828-134302850 CAGCAAAAGCAGTACTAAGAGGG + Intergenic
1198665241 X:139014099-139014121 CAGCAAAAGCAGTACTAAGAGGG + Intronic
1198781482 X:140241402-140241424 CAGCAAAAGCAGTACTAAGAGGG - Intergenic
1198855841 X:141015174-141015196 CAGCAAAAGCAGTATTAAGAGGG - Intergenic
1198872433 X:141189917-141189939 CAGCAAAAGCAGTACTAAGAAGG - Intergenic
1198876289 X:141230965-141230987 CAGCAAAAGCAGTATTAAGAGGG + Intergenic
1198906852 X:141572193-141572215 CAGCAAAAGCAGTATTAAGAGGG + Intergenic
1198917146 X:141685872-141685894 CAGCAAAAGCAGTATTAAGAGGG + Intronic
1198938631 X:141928185-141928207 CAGCAAAAGCAGTACTAAGAGGG - Intergenic
1198971804 X:142289926-142289948 CAACAGAAGCAGAAAGGACATGG - Intergenic
1198978011 X:142359021-142359043 CAGAAGAAGATGAAAGAAGAAGG - Intergenic
1199075954 X:143526532-143526554 CAGCAAAAGCAGTATTAAGTAGG - Intergenic
1199227997 X:145401402-145401424 CAGCAAAAGCAGTATTAAGAAGG + Intergenic
1199327586 X:146517646-146517668 CAGCAAAAGCAGTAGTAAGAGGG - Intergenic
1199755262 X:150858691-150858713 CAGCAAAAGCAGTATTAAAAGGG + Intronic
1200258346 X:154597851-154597873 CAACAGTAGCAGTATGAAAATGG + Intergenic
1200482562 Y:3724495-3724517 CAGCAAAAGCAGAACTAAGAGGG + Intergenic
1200571062 Y:4830038-4830060 CAGCTGAAGCAGAATTAAGAGGG + Intergenic
1201909424 Y:19119322-19119344 CACCAGAGGCAGAATGAAGCTGG - Intergenic