ID: 1174584797

View in Genome Browser
Species Human (GRCh38)
Location 20:51600062-51600084
Sequence TCCACTGCCGGCAGATTTCA AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 107
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 99}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1174584797_1174584801 8 Left 1174584797 20:51600062-51600084 CCTTGAAATCTGCCGGCAGTGGA 0: 1
1: 0
2: 1
3: 6
4: 99
Right 1174584801 20:51600093-51600115 CAGATCCCAACGCTGTAGCTTGG 0: 1
1: 0
2: 0
3: 6
4: 69
1174584797_1174584806 25 Left 1174584797 20:51600062-51600084 CCTTGAAATCTGCCGGCAGTGGA 0: 1
1: 0
2: 1
3: 6
4: 99
Right 1174584806 20:51600110-51600132 GCTTGGGCGTCCTCCCACCAGGG 0: 1
1: 1
2: 12
3: 164
4: 537
1174584797_1174584805 24 Left 1174584797 20:51600062-51600084 CCTTGAAATCTGCCGGCAGTGGA 0: 1
1: 0
2: 1
3: 6
4: 99
Right 1174584805 20:51600109-51600131 AGCTTGGGCGTCCTCCCACCAGG 0: 1
1: 0
2: 0
3: 7
4: 109
1174584797_1174584807 26 Left 1174584797 20:51600062-51600084 CCTTGAAATCTGCCGGCAGTGGA 0: 1
1: 0
2: 1
3: 6
4: 99
Right 1174584807 20:51600111-51600133 CTTGGGCGTCCTCCCACCAGGGG 0: 1
1: 0
2: 0
3: 14
4: 111
1174584797_1174584802 9 Left 1174584797 20:51600062-51600084 CCTTGAAATCTGCCGGCAGTGGA 0: 1
1: 0
2: 1
3: 6
4: 99
Right 1174584802 20:51600094-51600116 AGATCCCAACGCTGTAGCTTGGG 0: 1
1: 0
2: 1
3: 5
4: 93

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1174584797 Original CRISPR TCCACTGCCGGCAGATTTCA AGG (reversed) Exonic
901079189 1:6574327-6574349 TCCACTGGAGGCAGTTTGCAAGG - Intronic
909057078 1:70833915-70833937 TCCACTCCTGGCTGCTTTCATGG - Intergenic
910605711 1:89081594-89081616 TCAACTGCCAGGACATTTCATGG + Intergenic
912697224 1:111850451-111850473 TCCACTGTGGGGACATTTCAAGG - Intronic
918910557 1:190562985-190563007 TCCACTGACAGCCAATTTCATGG + Intergenic
923527088 1:234780795-234780817 TCCAGTGCTGGCAGAGATCATGG + Intergenic
923738732 1:236636116-236636138 TCCACAGCCGGGTGATTACAGGG - Intergenic
1064695787 10:17964004-17964026 TCCACTGTTGGCTGATTCCATGG + Intronic
1065625053 10:27621489-27621511 TCCACTGCTGGGAGTTCTCAAGG - Intergenic
1070237617 10:74645809-74645831 TCCATTAATGGCAGATTTCAAGG + Intronic
1071470582 10:85981318-85981340 TCCTTTGCCTGCATATTTCAAGG - Intronic
1073682029 10:105715207-105715229 TCCACTCCCTTCAGAATTCAGGG - Intergenic
1077280676 11:1743830-1743852 TACACTGGTTGCAGATTTCATGG + Intronic
1086438198 11:86801743-86801765 TCCACTCCTGACAGACTTCATGG - Intronic
1090861228 11:130654382-130654404 TCCACTGGTGCCAGATTTCCAGG + Intergenic
1093409649 12:18849071-18849093 TCTACTGCCTCCAGATTTCTTGG - Intergenic
1102873867 12:116434797-116434819 TGCAGTGCAGGCAGCTTTCATGG + Intergenic
1112651918 13:101408806-101408828 TCCAGTCCCAGCAGACTTCAAGG + Intronic
1113076062 13:106469137-106469159 TTCCTTGCAGGCAGATTTCAAGG - Intergenic
1113890104 13:113731205-113731227 TCCCTTGCTGGCAGGTTTCATGG + Exonic
1118214527 14:63796224-63796246 TCCACTGCAGGCAGATCACAAGG + Intergenic
1119955902 14:78798465-78798487 TCCTCTCCTGGCAGCTTTCATGG + Intronic
1120477934 14:85011956-85011978 ACCACTGCCAGAATATTTCATGG - Intergenic
1120484139 14:85088888-85088910 TTAACTGGTGGCAGATTTCAGGG - Intergenic
1122034489 14:98937437-98937459 GCCATTGCCCTCAGATTTCAGGG - Intergenic
1123998668 15:25736224-25736246 TCCGCGGCAGGCACATTTCACGG + Intronic
1128556519 15:68635469-68635491 TCCCCTGCAGGCAGATCCCATGG - Intronic
1129831167 15:78671822-78671844 TCCACTAACAGCAGATTTCCCGG - Intronic
1131922090 15:97339214-97339236 TTCACTGCCTGTAGATTTCTGGG + Intergenic
1151665099 17:75541231-75541253 ACCACTGCCTGCAGACTCCAGGG - Intronic
1152027745 17:77822700-77822722 TCCACTGCCGGAAGAATCCAGGG - Intergenic
1154246161 18:12701839-12701861 TCCGCGCCCGGCAGATATCAGGG - Intronic
1160701034 19:507539-507561 ACCACCGCCGGCCGGTTTCACGG + Exonic
1162623102 19:11860449-11860471 TCAGCTGCCGGCAGATATCCTGG + Intronic
1163478481 19:17540381-17540403 TCCACTCCCAGCGGATATCAGGG + Exonic
1166154454 19:40900364-40900386 ACCTCTGCCTGCAGGTTTCATGG + Intergenic
1166173657 19:41050218-41050240 ACCTCTGCCTGCAGGTTTCATGG - Intergenic
925458233 2:4037440-4037462 TCCACTGTTGGATGATTTCATGG - Intergenic
929883748 2:45860455-45860477 TCCTCTGAAGGCAGATTTCTAGG + Intronic
930120617 2:47757702-47757724 CCAACTGCTGGCAGATTCCATGG - Intronic
935491981 2:103733132-103733154 TTCACTTCTGGAAGATTTCATGG + Intergenic
936269277 2:111036411-111036433 TCCACTGCCCACACATTTAACGG - Intronic
936484518 2:112914775-112914797 ACCACTTCCGCCAGATTTGAAGG - Intronic
937757147 2:125553985-125554007 GCCACTGCCTGCAGAACTCAAGG + Intergenic
939665096 2:144941912-144941934 TCCAAAGCAGGCAGCTTTCATGG + Intergenic
947794195 2:232883980-232884002 TGATCTGCCGGCAGATTCCAGGG - Exonic
948663449 2:239520515-239520537 TCCCCTTCCTGCAGATTTGATGG + Intergenic
1170324781 20:15144782-15144804 TCCAGTGCTGGCAGATTCCAGGG - Intronic
1174584797 20:51600062-51600084 TCCACTGCCGGCAGATTTCAAGG - Exonic
1177183575 21:17769373-17769395 TTCTCTGCCTGCAGATTTTATGG - Intergenic
1184096469 22:42318901-42318923 GCCTCTGCTGGCTGATTTCATGG - Intronic
951033309 3:17906357-17906379 TCCACTACAGTCTGATTTCAAGG - Intronic
951235108 3:20225986-20226008 TCCTCTTTCGGCAGATTTCTTGG + Intergenic
951841323 3:27037247-27037269 TTCACTGCAGGCAGAATTTAAGG - Intergenic
954762773 3:52888971-52888993 CCCACTGAGGGCAGGTTTCATGG - Intronic
959505365 3:107151182-107151204 TCAGCTGCAAGCAGATTTCAGGG + Intergenic
960118861 3:113926743-113926765 TTCACTTCTGGAAGATTTCAGGG + Intronic
960793642 3:121460464-121460486 TCCACGGTGGGCAGATGTCAGGG - Intronic
962809275 3:138947322-138947344 GCGAGTACCGGCAGATTTCAAGG - Exonic
964031525 3:152144653-152144675 TCCACTGTCCACACATTTCATGG + Intergenic
964862197 3:161215268-161215290 GCCACTGGCAGCAGATTGCATGG - Intronic
966964864 3:184981050-184981072 TTCATTTCCGGAAGATTTCAGGG + Intronic
975694112 4:76994528-76994550 TTCACTGTTGGCAGGTTTCAAGG + Intronic
976138956 4:81970455-81970477 TCCACTGCTTGCGCATTTCATGG - Intronic
979269825 4:118746568-118746590 TCCAGTGCAAGCAGATGTCAGGG - Intronic
979447016 4:120825878-120825900 TCAATTGCAGGCAGACTTCATGG - Intronic
980007698 4:127560063-127560085 TGCACTGCAGGCAGCTTCCATGG - Intergenic
980257539 4:130402141-130402163 TTCACTTCTGGAAGATTTCAGGG + Intergenic
980560051 4:134460656-134460678 TCCACTCCTGGCTGCTTTCATGG - Intergenic
981546103 4:145895160-145895182 TCCACTGACCTGAGATTTCATGG + Intronic
984454335 4:179945527-179945549 TCCACTCCTGGCTGGTTTCATGG - Intergenic
984864728 4:184271895-184271917 TCCACTGCCCACAGAATTCCTGG + Intergenic
988004703 5:25394085-25394107 ACCACTGCCAGCTTATTTCAAGG - Intergenic
989289073 5:39740604-39740626 TCCACTGTCGCCAGGTCTCAGGG - Intergenic
990302297 5:54460933-54460955 TACACTGCCTTCAGATTTTATGG + Intergenic
994686469 5:102959780-102959802 TCCATTGCTGGCAGATCTAAGGG + Intronic
994789625 5:104206827-104206849 CCCACTGGTGGCATATTTCAGGG + Intergenic
995627186 5:114092386-114092408 TCCACTCCCAGCTGCTTTCACGG + Intergenic
998532131 5:142895058-142895080 TCCACAGCAGGAAGACTTCATGG + Intronic
1001781153 5:174370199-174370221 TCCAGTGCTGGCAGATTATAAGG + Intergenic
1007106505 6:39286900-39286922 ACCTCTGCCTCCAGATTTCAAGG + Intergenic
1015239654 6:131008627-131008649 CCCACTCCCGGCTGCTTTCATGG - Intronic
1017766038 6:157608256-157608278 TCCACTGACGGCCGATTATATGG + Intronic
1021987093 7:26107472-26107494 TCCACTGCCTGCAGTCTTGAGGG - Intergenic
1024523961 7:50332444-50332466 TCCCCTGCTGCCTGATTTCATGG - Intronic
1026979217 7:74516800-74516822 TCCACTTTGGGCAGAATTCAAGG + Intronic
1028138765 7:87248796-87248818 TCCACTGCCTGCAGTTTCCCAGG - Intergenic
1029467629 7:100736356-100736378 ACCACACCCGGCTGATTTCATGG + Intronic
1029945947 7:104533185-104533207 TCCAGTGCTGGCAGAGGTCAAGG - Intronic
1034405228 7:150898433-150898455 TCAACTGCGGGCAGTTTCCAAGG - Intergenic
1034924873 7:155113152-155113174 TCCACTGTCTGCAGTTTTCTGGG - Intergenic
1037018255 8:13935317-13935339 TCTACTCCAGGCTGATTTCATGG + Intergenic
1037263988 8:17037752-17037774 CCCACTCCCGGCTGCTTTCATGG - Intronic
1039933195 8:42013754-42013776 TCCACTGACTGCAGATTTAAAGG + Intronic
1041823799 8:62068617-62068639 CCCACTCCCGGCAGCTGTCATGG - Intergenic
1044273367 8:90272512-90272534 TTCCTTGCCTGCAGATTTCAGGG - Intergenic
1053109906 9:35449790-35449812 TCCACTGGCTGCGGATTTTATGG + Intergenic
1054510170 9:65966751-65966773 TTCACTGCTGGGAGATTACAGGG + Intergenic
1057807159 9:98227840-98227862 ACCACTGTCAGCAGATCTCAGGG - Intronic
1060157463 9:121329617-121329639 TCCTCTGCCAACAGATTTAAAGG - Intronic
1061629124 9:131860537-131860559 GCTACTGCCGGCAGGTGTCATGG + Exonic
1186277794 X:7958568-7958590 TCCACTGCAGGCAGACTTCAGGG + Intergenic
1190690367 X:52908625-52908647 TCCCCTGCTGGGAGATTTCAAGG - Intergenic
1190695616 X:52947167-52947189 TCCCCTGCTGGGAGATTTCAAGG + Intronic
1196011930 X:110898063-110898085 CCCACTGCTGGCTGCTTTCATGG + Intergenic
1198401704 X:136274949-136274971 TCCATTTCAGGTAGATTTCAGGG - Intergenic
1198841914 X:140865895-140865917 TCCAATACTGGAAGATTTCAGGG - Intergenic