ID: 1174584798

View in Genome Browser
Species Human (GRCh38)
Location 20:51600074-51600096
Sequence TCTGGGATCTGTTCCACTGC CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 177
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 166}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1174584798_1174584807 14 Left 1174584798 20:51600074-51600096 CCGGCAGTGGAACAGATCCCAGA 0: 1
1: 0
2: 0
3: 10
4: 166
Right 1174584807 20:51600111-51600133 CTTGGGCGTCCTCCCACCAGGGG 0: 1
1: 0
2: 0
3: 14
4: 111
1174584798_1174584806 13 Left 1174584798 20:51600074-51600096 CCGGCAGTGGAACAGATCCCAGA 0: 1
1: 0
2: 0
3: 10
4: 166
Right 1174584806 20:51600110-51600132 GCTTGGGCGTCCTCCCACCAGGG 0: 1
1: 1
2: 12
3: 164
4: 537
1174584798_1174584801 -4 Left 1174584798 20:51600074-51600096 CCGGCAGTGGAACAGATCCCAGA 0: 1
1: 0
2: 0
3: 10
4: 166
Right 1174584801 20:51600093-51600115 CAGATCCCAACGCTGTAGCTTGG 0: 1
1: 0
2: 0
3: 6
4: 69
1174584798_1174584802 -3 Left 1174584798 20:51600074-51600096 CCGGCAGTGGAACAGATCCCAGA 0: 1
1: 0
2: 0
3: 10
4: 166
Right 1174584802 20:51600094-51600116 AGATCCCAACGCTGTAGCTTGGG 0: 1
1: 0
2: 1
3: 5
4: 93
1174584798_1174584805 12 Left 1174584798 20:51600074-51600096 CCGGCAGTGGAACAGATCCCAGA 0: 1
1: 0
2: 0
3: 10
4: 166
Right 1174584805 20:51600109-51600131 AGCTTGGGCGTCCTCCCACCAGG 0: 1
1: 0
2: 0
3: 7
4: 109

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1174584798 Original CRISPR TCTGGGATCTGTTCCACTGC CGG (reversed) Exonic
901024348 1:6271112-6271134 TCTGGGCTCTCTTCCACTGGAGG + Intronic
901954268 1:12772614-12772636 GCTGGGAAATGTTCCACTGTGGG + Intergenic
901956573 1:12789964-12789986 GCTGGGAAATGTTCCACTGTGGG + Intergenic
901979955 1:13026108-13026130 GCTGGGAAATGTTCCACTGTGGG + Intronic
902002132 1:13202823-13202845 GCTGGGAAATGTTCCACTGTGGG - Intergenic
902021359 1:13348563-13348585 GCTGGGAAATGTTCCACTGTGGG - Intergenic
904029085 1:27522899-27522921 TCTGGGCTTGGTTCCACTGGGGG + Intergenic
904937643 1:34142900-34142922 TTTGTGATTTGTGCCACTGCTGG + Intronic
907471967 1:54679876-54679898 TCTGGGATCTGGGGCACAGCCGG - Exonic
908380753 1:63594429-63594451 CCCGGGATCTGTTCCACCGACGG + Intronic
908780742 1:67686802-67686824 ACAGGGATCTCTTCCGCTGCTGG - Intronic
909117833 1:71562004-71562026 TTTTGAATCTGTTCCACTGGTGG + Intronic
912548063 1:110465521-110465543 CCTGGGAGCTGCCCCACTGCAGG + Intergenic
912623500 1:111189182-111189204 TCTGGGTTCAGATCCCCTGCAGG - Intronic
913053891 1:115139933-115139955 TCTGGGAGCTGTGCCATTGGAGG + Intergenic
915283646 1:154839300-154839322 TATGGGATCTGTTCCCCTTCTGG - Intronic
917593149 1:176498268-176498290 TCTGGGACCTGCTCCTCTCCAGG + Intronic
917905575 1:179584587-179584609 TCTGGGATCTGATTTAGTGCCGG - Intergenic
918423855 1:184388402-184388424 TATGGGATCTCTTCCATTGCCGG + Intronic
919303757 1:195803336-195803358 TCTGGAGTTTGTTCCACTTCAGG + Intergenic
921489721 1:215760299-215760321 ACTGGGATCTCTTCCCCTCCTGG + Intronic
923371852 1:233322476-233322498 TCTGGGACCTGTTCCCCATCTGG - Intergenic
923555423 1:234997158-234997180 ACTGGGGTCTGTTCCTCTGAGGG - Intergenic
1063461695 10:6218975-6218997 TCTGGGGCCTGTGCCACTGTGGG + Intronic
1064261109 10:13787326-13787348 TCTGAGCTCTGTTTCTCTGCAGG - Intronic
1066415802 10:35220352-35220374 TATGGGAACTCTTCCACAGCTGG + Intergenic
1067255179 10:44630823-44630845 TCTGGGACCCTGTCCACTGCAGG + Intergenic
1067345206 10:45433289-45433311 TGTGGGATCTGCTCCGGTGCTGG - Intronic
1069854141 10:71430161-71430183 TCTGTGGGCTGTTCCCCTGCTGG + Intronic
1075475582 10:122730830-122730852 GCTGGGACCTTTCCCACTGCAGG + Intergenic
1075786560 10:125053880-125053902 TGTGGAATCTGATCCTCTGCCGG - Intronic
1076377779 10:130003113-130003135 TCTGGCTCCTGTCCCACTGCAGG + Intergenic
1077257655 11:1595554-1595576 ACTGTGATCTGTTTCACGGCAGG + Intergenic
1077455514 11:2676478-2676500 TCTGGCATCAGTTCCATTTCTGG + Intronic
1077657976 11:4040552-4040574 GCAAAGATCTGTTCCACTGCCGG + Intronic
1082139742 11:48595127-48595149 TCTGGCATCTGTTCAACTTCTGG + Intergenic
1083015382 11:59447863-59447885 TTTGGGATCTGTCTCCCTGCAGG - Intergenic
1084804319 11:71568337-71568359 ACTGTGATCTGTTTCACAGCAGG - Intronic
1086348687 11:85923531-85923553 GATGGGAACTGTTCCACTCCTGG - Intergenic
1087751600 11:102013116-102013138 GCTGAGCTCTCTTCCACTGCAGG - Intergenic
1095678456 12:44947164-44947186 ACAGGAATCTGTTCCAATGCTGG - Intergenic
1099668782 12:85663728-85663750 GCTGGCATCTGCTCCACTTCTGG + Intergenic
1108927823 13:55775402-55775424 CCTGGGATTTGTTCCACAGAGGG - Intergenic
1109807615 13:67465052-67465074 TTTGAGATCTGTTGCACAGCAGG - Intergenic
1109882851 13:68504130-68504152 TTTGAGATTTATTCCACTGCAGG + Intergenic
1110392540 13:74992092-74992114 TTTGGGAACTTCTCCACTGCAGG + Intergenic
1118754429 14:68829053-68829075 TCTGTGTTCTGTACCACTGTAGG + Intergenic
1119668525 14:76501095-76501117 CTTGAGATCTGTTCCACTGGGGG - Exonic
1120952726 14:90057358-90057380 TCTGGGATATGTTGCACTTGGGG - Intergenic
1122627167 14:103090618-103090640 TCTGGACTCTGTTCTACTACAGG + Intergenic
1124226884 15:27902722-27902744 TTTGGGAACTCTTCCTCTGCAGG + Intronic
1125318005 15:38452997-38453019 GCTGGCATCTGCTCCACTCCTGG - Intergenic
1125752107 15:42036324-42036346 TCTGGGCCCAGTTCCACTTCAGG - Intronic
1130025395 15:80266783-80266805 TTTGGGATCTGTGCCACTTGAGG + Intergenic
1130878051 15:88031545-88031567 TCTGGGTTCTGAACCACGGCTGG - Intronic
1132604333 16:787477-787499 TCTGGACTCTGTCCCACTCCAGG - Exonic
1135137325 16:19894894-19894916 TCTCTGTTCTGTCCCACTGCTGG + Intergenic
1135888495 16:26335645-26335667 TCTGGGCTCTGTCCCAGAGCTGG + Intergenic
1137667426 16:50259861-50259883 GCAGGGATCTGTTCCTGTGCAGG - Intronic
1140458220 16:75116673-75116695 CCTGGGAGCTGTTCCCCTGGAGG - Exonic
1144170257 17:12653060-12653082 TTTGGGCTCTGTTCCTCAGCGGG + Intergenic
1148860755 17:50603212-50603234 TCTTGGAGGTGTTCCAGTGCTGG - Intronic
1149958164 17:61076728-61076750 TCTGGGCTCTGTGACACTGATGG + Intronic
1150825262 17:68468917-68468939 CCAGGGATCTGTTCCACAGATGG + Intergenic
1152424831 17:80213304-80213326 TCTGGGGGCTGTGCCAGTGCTGG - Intronic
1152928158 17:83097349-83097371 TCTGGGACCTGTCCTCCTGCAGG + Intergenic
1154197661 18:12278460-12278482 TCTTGGATCTGATTCCCTGCAGG + Intergenic
1154396113 18:13990823-13990845 GCTGGCATCTGCTCCACTTCTGG - Intergenic
1157800281 18:50614881-50614903 TCAGGAATCTGTTACATTGCTGG + Intronic
1158578132 18:58657609-58657631 TTTGGGATCTGTTCCAGAGAAGG - Intergenic
1160058892 18:75511489-75511511 TCTTGGTTTTGATCCACTGCTGG - Intergenic
1160628188 18:80227767-80227789 TCTGGGGTCTGTTCTGCTGAAGG - Intronic
1162533803 19:11251468-11251490 GCTGGGATTTGATCCAGTGCAGG - Intronic
1162843376 19:13372527-13372549 TCTGGGATCTGAACCCATGCAGG - Intronic
1163497634 19:17655910-17655932 TCAGGGATCTGCTCAGCTGCAGG + Exonic
1163524109 19:17809952-17809974 TCTGGTAGCTGTTTCTCTGCGGG + Intronic
1165499318 19:36175236-36175258 TTTGGGATCTCTTCTACTGTAGG + Intergenic
1165709381 19:37999268-37999290 CCTGGGATCCCTTTCACTGCTGG + Intronic
1168255735 19:55164072-55164094 GCAGGCATCTGTTCCACGGCAGG - Intronic
1168693006 19:58388162-58388184 TCTGGGGTCTCTGCCACCGCTGG - Exonic
927514593 2:23664763-23664785 TCTGGGGTCTGTCCCATGGCAGG - Intronic
928076848 2:28272926-28272948 GCTGGGATCTGTCTCACTGGAGG + Intronic
928728306 2:34201710-34201732 CCTGGGGTCTGGTCCAATGCAGG + Intergenic
932187944 2:69714635-69714657 TCTGGGATCTGGCCCAACGCAGG - Intronic
932259738 2:70317182-70317204 GCTGGGCTCTGTTCCACCACAGG + Intergenic
936152859 2:110031129-110031151 TCTGGGAAATGTCCCACTGCAGG - Intergenic
936191821 2:110340283-110340305 TCTGGGAAATGTCCCACTGCAGG + Intergenic
936484802 2:112916623-112916645 GCAGGGATCTGTTCCACTCTAGG + Intronic
938616138 2:133000776-133000798 GCTGGTATATATTCCACTGCAGG - Intronic
940002890 2:148984600-148984622 TCTGGGATATGTTTCCCTCCTGG - Intronic
944325790 2:198401966-198401988 TCTGCCCTCTGTTCCACTGTAGG + Intronic
946413138 2:219525721-219525743 CCTGGGAGCTGTTCCACCCCAGG + Intronic
947838771 2:233194078-233194100 TCTGAGATCTTTTCCAGTGCTGG - Intronic
948534739 2:238637497-238637519 TCTGGGAGATGTTCACCTGCTGG + Intergenic
1170792923 20:19522471-19522493 TCTGGGACTTGTTCCAAAGCAGG - Intronic
1173222769 20:41143031-41143053 TCAGGGCTCTTTCCCACTGCTGG + Intronic
1174144230 20:48439847-48439869 TCTGAGATCTTTTCCTCTCCTGG + Intergenic
1174336892 20:49868806-49868828 TGGGGCATCTGTGCCACTGCTGG + Intronic
1174443278 20:50573237-50573259 TCTGTGATCTGGGCCTCTGCTGG + Intronic
1174584798 20:51600074-51600096 TCTGGGATCTGTTCCACTGCCGG - Exonic
1178616299 21:34136028-34136050 TCAGGGGTCTCTACCACTGCTGG + Intronic
1179389788 21:40977396-40977418 TGTGCGATCTCTTCCACTCCTGG - Intergenic
1179403335 21:41104604-41104626 TCTGGCATCAGTGCCATTGCAGG - Intergenic
1180106672 21:45623177-45623199 TCTGGCATCTGAGGCACTGCTGG + Intergenic
1181481803 22:23204705-23204727 TCTGAAATCTGTTCCAGTCCTGG - Intronic
1183715097 22:39528839-39528861 GCTGGGAGCAGTTCCAGTGCAGG - Intergenic
1183856434 22:40637881-40637903 TCTGGGCTCTCTCCCATTGCTGG - Intergenic
1184610127 22:45598065-45598087 TCTGTGAACAGTTCCTCTGCAGG - Intronic
1184787048 22:46676963-46676985 TCTTGGCTCTGTTCCCCTGAAGG + Intronic
956771936 3:72534394-72534416 TTTGGGATTTTTTCCACTGAGGG + Intergenic
959028842 3:101273678-101273700 TCTGCAATCTGTTCACCTGCTGG + Exonic
959897760 3:111624378-111624400 TTTGGTATCTGTCCCACTGGAGG - Exonic
962853196 3:139323258-139323280 TCTGGGTTCTGCTCTACTGTGGG - Intronic
966884550 3:184369366-184369388 CCTGGGAGCTGGTCCCCTGCTGG + Intronic
968448200 4:663085-663107 TCTGGGACCTGTTACACAGGTGG - Exonic
969924141 4:10569881-10569903 TTTGGTATCTATTCCACAGCAGG + Intronic
970961334 4:21874470-21874492 TCTGGGATCTGACCCACAGAGGG + Intronic
975944951 4:79695334-79695356 TCTGTGATGTGATCCACTTCAGG + Intergenic
976430610 4:84959748-84959770 GCTGGGATATGTCCAACTGCTGG - Intronic
976748717 4:88432313-88432335 TCTGAGATCTGAAACACTGCTGG + Intronic
977489355 4:97692158-97692180 TCTTGGTTTTGATCCACTGCTGG - Intronic
979561757 4:122108910-122108932 TCTGGGTTTGGATCCACTGCTGG - Intergenic
981611984 4:146603292-146603314 ACTTGGATCTGTTTCACTTCGGG + Intergenic
982059586 4:151591353-151591375 TCTGGGCTCAGGTCCACTGGAGG + Intronic
982969960 4:161972566-161972588 TCTGGGGCCTGTTCCACTAGGGG - Intronic
989009498 5:36854527-36854549 TCTCGGATGTGTTCAACTGGTGG - Intergenic
992962603 5:81971581-81971603 TCTGGGATATGTGCCACAGATGG + Intergenic
993461598 5:88189518-88189540 TCTGGGGTCCTTTCCACTGTGGG + Intergenic
993641286 5:90409465-90409487 TCTGGGCTCTGATGCCCTGCAGG - Intronic
996694235 5:126376316-126376338 TCTGGGATGAGGTCCACTCCAGG + Intronic
997532744 5:134592266-134592288 TCTGGGGTCAGTTCCACTCTAGG + Intergenic
999125741 5:149244607-149244629 GCTGGGATCTGGTCCAGTTCTGG + Intronic
999839033 5:155404005-155404027 TCTTGGTTTTGATCCACTGCTGG - Intergenic
1000279390 5:159769016-159769038 TCTGGGGTCTGTACAACTCCAGG + Intergenic
1000965262 5:167648450-167648472 TTGGGGATCTGTTCCAGTGATGG + Intronic
1001468590 5:171991408-171991430 ACTGTGAACTGTTCCAATGCTGG - Intronic
1007187471 6:39984463-39984485 CCTGGGATGTCTTCCACTGGAGG + Intergenic
1007803901 6:44422679-44422701 TTTGGGAGTTGTTCCACTCCGGG - Exonic
1011516891 6:88165623-88165645 ACTGTGATCTGTTCTACTTCTGG - Intronic
1012016242 6:93856020-93856042 TCTTGGATGTGATCCACTGCTGG + Intergenic
1013396202 6:109743158-109743180 TCTGTGATGTCTTTCACTGCAGG + Exonic
1013493345 6:110672319-110672341 TCAGGGATCTGTGCCAGTGTTGG - Intronic
1013991520 6:116259069-116259091 TCTGGGGTCTCTGCCACTGCTGG + Intronic
1020042272 7:5013052-5013074 TCTGGGATCTGGCCCAACGCAGG - Intronic
1021130045 7:16900435-16900457 TCTTGGTTCTGTGCCACTCCTGG + Intergenic
1024229230 7:47351574-47351596 ACTGGATTCTGTTCCACTACTGG - Intronic
1024860697 7:53836261-53836283 GCTGGCATCTGCTCCACTTCTGG - Intergenic
1025259962 7:57412348-57412370 TCTGGCCTCTGCTCCACTGATGG + Intergenic
1025786576 7:64649500-64649522 ACTTGGATCTGTTCCACAGATGG + Intergenic
1026952561 7:74357228-74357250 TCAGGGATCTGAAGCACTGCAGG - Intronic
1027229624 7:76264655-76264677 TCTGAGATTTGTTCCACTCTAGG - Intronic
1027998816 7:85464706-85464728 TCTGGTATCTGCTCAAATGCAGG + Intergenic
1029033995 7:97499385-97499407 GCTGGGATTTGTTCATCTGCTGG + Intergenic
1029491438 7:100872602-100872624 TCTTGGTTCTCTTCCCCTGCAGG + Exonic
1035436824 7:158865657-158865679 GCTGGGGTTTGTTCCACTCCTGG + Intronic
1035570267 8:667922-667944 TCTGGGATAGGTGCCACTGACGG + Intronic
1036609623 8:10338412-10338434 TTTGAGATCTGTTGCACAGCAGG + Intronic
1040524886 8:48212618-48212640 TCTTGGTTCGGATCCACTGCTGG - Intergenic
1042092072 8:65169274-65169296 ACTGGGATGTGTTCCAGTGGAGG + Intergenic
1042936267 8:74061542-74061564 TGTGAGATCTGTTGCACAGCAGG + Intergenic
1043666447 8:82820952-82820974 CCTGGGCTGTGTTCCACTGTGGG + Intergenic
1047533128 8:125695274-125695296 TCTGGGAACTGTACCAGGGCAGG + Intergenic
1048508643 8:135042869-135042891 CCAGGGATCTGATCCTCTGCAGG + Intergenic
1048869290 8:138783925-138783947 TCTGGGCTCTGAGCCACAGCAGG - Intronic
1049432411 8:142571461-142571483 GCTGGGAGCTCTTCCAGTGCTGG - Intergenic
1050021713 9:1291598-1291620 TGTGGGGTCTGGTCCTCTGCTGG - Intergenic
1052760418 9:32584746-32584768 TGTGGGATGTGTTACACAGCAGG - Intergenic
1055139456 9:72859517-72859539 TCTGGCATCTGCTCCATTTCCGG + Intergenic
1057643672 9:96853332-96853354 TCTAGGATCTGCTCCTCTGTGGG + Intronic
1062563995 9:137155846-137155868 TCTGGGCTCTGTCCTCCTGCAGG + Intronic
1186308487 X:8290627-8290649 TCTTGGTTCAGTTCCATTGCTGG - Intergenic
1186872295 X:13784845-13784867 CCTGGGATCTGCTCTTCTGCTGG + Intronic
1186884920 X:13903560-13903582 TCTTGGATCTTCTCCAATGCAGG + Intronic
1187705690 X:22007281-22007303 ACTTGAAACTGTTCCACTGCTGG - Intergenic
1190922264 X:54865284-54865306 TCTGGCATCTGCTCAACTTCTGG + Intergenic
1194614969 X:96088791-96088813 TCTTGGTTTTGATCCACTGCTGG - Intergenic
1202081185 Y:21085698-21085720 TCTGGGATCTTTTCCACAGGGGG + Intergenic