ID: 1174584801

View in Genome Browser
Species Human (GRCh38)
Location 20:51600093-51600115
Sequence CAGATCCCAACGCTGTAGCT TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 76
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 69}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1174584792_1174584801 24 Left 1174584792 20:51600046-51600068 CCTTTCAGCAAGTTCCCCTTGAA 0: 1
1: 0
2: 3
3: 13
4: 138
Right 1174584801 20:51600093-51600115 CAGATCCCAACGCTGTAGCTTGG 0: 1
1: 0
2: 0
3: 6
4: 69
1174584795_1174584801 9 Left 1174584795 20:51600061-51600083 CCCTTGAAATCTGCCGGCAGTGG 0: 1
1: 0
2: 1
3: 8
4: 80
Right 1174584801 20:51600093-51600115 CAGATCCCAACGCTGTAGCTTGG 0: 1
1: 0
2: 0
3: 6
4: 69
1174584794_1174584801 10 Left 1174584794 20:51600060-51600082 CCCCTTGAAATCTGCCGGCAGTG 0: 1
1: 0
2: 0
3: 4
4: 64
Right 1174584801 20:51600093-51600115 CAGATCCCAACGCTGTAGCTTGG 0: 1
1: 0
2: 0
3: 6
4: 69
1174584798_1174584801 -4 Left 1174584798 20:51600074-51600096 CCGGCAGTGGAACAGATCCCAGA 0: 1
1: 0
2: 0
3: 10
4: 166
Right 1174584801 20:51600093-51600115 CAGATCCCAACGCTGTAGCTTGG 0: 1
1: 0
2: 0
3: 6
4: 69
1174584797_1174584801 8 Left 1174584797 20:51600062-51600084 CCTTGAAATCTGCCGGCAGTGGA 0: 1
1: 0
2: 1
3: 6
4: 99
Right 1174584801 20:51600093-51600115 CAGATCCCAACGCTGTAGCTTGG 0: 1
1: 0
2: 0
3: 6
4: 69

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1174584801 Original CRISPR CAGATCCCAACGCTGTAGCT TGG Exonic
900877435 1:5353321-5353343 CAGCCCCCATCTCTGTAGCTGGG + Intergenic
901456586 1:9366515-9366537 CAGATCCCAGCCCTGAACCTTGG + Intronic
902282330 1:15383641-15383663 CAGATCCCAAGGCTGGGGTTAGG + Intronic
912523840 1:110266218-110266240 CAGATCCCAACACTGTTGCATGG + Intronic
920536945 1:206743709-206743731 CAGGTCCCTAAGCTGTGGCTTGG - Intergenic
923124084 1:231020522-231020544 CAGATCCTAACGCAGTAGCAGGG - Intronic
1068008828 10:51422264-51422286 GAGATCCAAACTCTGTAGTTAGG + Intronic
1068900709 10:62266818-62266840 CAGTTTCCACCGTTGTAGCTTGG - Intronic
1069546520 10:69333244-69333266 CAAATCCCAATGCTGTGGCTTGG - Intronic
1075085672 10:119412868-119412890 CAGACCCCGTCGCTGCAGCTGGG + Intronic
1081806292 11:45892615-45892637 CAGCTCCCAAAGCAGTAGCATGG - Intronic
1082715227 11:56604156-56604178 CAGATGAAAACGCTGAAGCTCGG - Intergenic
1089182665 11:116593757-116593779 CTGAGCCCAAGGCTGTAGCAAGG + Intergenic
1107349106 13:39495726-39495748 CAGATACCAACCTTGAAGCTGGG + Intronic
1107595782 13:41961284-41961306 CAGAGCCCAGCGCCGCAGCTCGG - Intergenic
1117203324 14:53414716-53414738 CTGAGCCCATCGCTGTAGCCAGG + Intergenic
1117993187 14:61454840-61454862 AAGATCTGAACGGTGTAGCTTGG + Intronic
1119324843 14:73753721-73753743 CAGAGCCCCACACTGTTGCTAGG - Intronic
1120981344 14:90291981-90292003 CAGATACCAACTCTGTGTCTTGG - Intronic
1121108775 14:91297803-91297825 CAGATACCAAAGCTGTAGCATGG - Intronic
1124163307 15:27294643-27294665 CAGATTCTCAGGCTGTAGCTGGG + Intronic
1129384468 15:75188336-75188358 CAGCTCCCAGTGCTGTGGCTGGG - Intergenic
1132594092 16:740453-740475 CAGATGCAAAGGCTGTGGCTTGG + Intronic
1133789295 16:8997067-8997089 CAGAGCCCATCCCTGGAGCTGGG - Intergenic
1135903901 16:26492781-26492803 CAGAACCCAACTCTATTGCTTGG - Intergenic
1139421682 16:66853095-66853117 CAGATTCCAACACAGTAGCGGGG - Intronic
1141683707 16:85558221-85558243 CAGATCCTCATGCTGTATCTGGG + Intergenic
1143027694 17:3950845-3950867 CAGAACCCAAGGCTGGGGCTGGG + Intronic
1150716469 17:67576533-67576555 CAGATCCCAATGCAGGTGCTGGG + Intronic
1152939015 17:83156005-83156027 CACATGCCAACCCTGTGGCTTGG + Intergenic
1158890341 18:61866405-61866427 CAGATTCTCACTCTGTAGCTTGG - Intronic
1164344742 19:24905156-24905178 CACATCACAACGCTGTTTCTGGG - Intergenic
1164344859 19:24907191-24907213 CAGATCACAACGCAGTTTCTGGG - Intergenic
1164752092 19:30664587-30664609 CAGATCCCACCTATGTAGGTGGG - Intronic
1165878230 19:39024864-39024886 CTGGTCCCAGCCCTGTAGCTCGG + Exonic
1166283104 19:41808309-41808331 CAGATTCTAACTCTGCAGCTGGG + Intronic
1167300693 19:48675850-48675872 CAGGTCCCAAGGCTAGAGCTGGG - Intergenic
1167595121 19:50423449-50423471 CAGATCACCACGCTGTGGCCAGG - Intronic
927812923 2:26190165-26190187 CTGGTCCCAGCTCTGTAGCTGGG - Intergenic
1172198981 20:33112041-33112063 CAAATCCCAACTCTGTCACTTGG + Intergenic
1174584801 20:51600093-51600115 CAGATCCCAACGCTGTAGCTTGG + Exonic
1175808164 20:61842686-61842708 CAGATTCCAGAGCTGTAGTTAGG - Intronic
1178510168 21:33198448-33198470 CAGAGCCCAAGGATGAAGCTTGG + Intergenic
1180219798 21:46351297-46351319 CACATCCCAAACCTGCAGCTCGG - Intronic
1184118188 22:42434100-42434122 CACACCCCAACTCTGTACCTCGG + Intergenic
949479590 3:4480903-4480925 CAGCCCCCAACTCAGTAGCTGGG - Intergenic
954014823 3:47678790-47678812 CAGTTACCAACCCTGTGGCTAGG - Intronic
957533819 3:81475212-81475234 CCAATCCCAACCCTCTAGCTGGG + Intergenic
961184742 3:124904939-124904961 CAGAGCCAACCTCTGTAGCTGGG + Intergenic
975267761 4:72391324-72391346 CATCTCTCAACTCTGTAGCTTGG - Intronic
982629273 4:157811242-157811264 GAGATTCCAACCCTTTAGCTGGG - Intergenic
983671953 4:170247635-170247657 CAGATCCCTAGGAAGTAGCTAGG - Intergenic
990335796 5:54771392-54771414 CAGCTCCCAATCCTGAAGCTCGG + Intergenic
994100056 5:95882212-95882234 CAGAGCCCAATGCTGTTGATGGG - Intergenic
998491352 5:142549902-142549924 CAGGTCCCATCTCTGTAACTTGG - Intergenic
1000325860 5:160171495-160171517 CAGACCCCAAAGCAGTTGCTGGG - Intergenic
1006787234 6:36676621-36676643 CAGATCCCAGCCCTGTCGCAAGG - Intronic
1015703910 6:136066764-136066786 CAGAGCACAAAGCTGAAGCTAGG + Intronic
1017750520 6:157486959-157486981 CACCTACCAATGCTGTAGCTGGG - Intronic
1018729190 6:166636192-166636214 CAGAACCCAAGGCTGGAGGTGGG - Intronic
1020820554 7:12962117-12962139 CAGATCACAAGGCTAAAGCTAGG - Intergenic
1023859028 7:44206031-44206053 CAGATCCCTAAGATATAGCTTGG + Intronic
1032332306 7:130991955-130991977 CAGAGCCCAGCTCTGTGGCTCGG - Intergenic
1038524664 8:28262746-28262768 GAGATCCCAACAGTGTTGCTGGG + Intergenic
1038840058 8:31176565-31176587 CAGATCCAAACGCTGTTACTAGG - Intergenic
1051312192 9:15788208-15788230 CAAATCCCAGCTCTGTTGCTTGG + Intronic
1054855440 9:69894270-69894292 CAGATCCTAAGGTTGAAGCTGGG - Intronic
1057046923 9:91893199-91893221 CAGAACCCCAGGCTGAAGCTGGG + Intronic
1057267633 9:93629736-93629758 CATATCCAGACGCTGTATCTAGG + Intronic
1059709257 9:116852362-116852384 CAAATCCCATCCCTGTAACTGGG - Intronic
1061900857 9:133671300-133671322 CAGATCCCAACACTGTCCCTGGG + Intronic
1188493016 X:30755942-30755964 CAGATCTCAACTCTGTAGGATGG + Intergenic
1196326097 X:114404949-114404971 CACCTCCCAACACTGTTGCTTGG - Intergenic
1197147793 X:123188270-123188292 CAGATCTCAAAGCTGTCTCTAGG + Intronic
1199467197 X:148151753-148151775 CACATACCAACTCTGTAGGTGGG + Intergenic
1199635762 X:149810044-149810066 CAGATCGCACTGCTGTAGCCTGG + Intergenic