ID: 1174584838

View in Genome Browser
Species Human (GRCh38)
Location 20:51600300-51600322
Sequence AACTAATTCTTTAGGCAACA TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 218
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 201}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1174584838_1174584841 10 Left 1174584838 20:51600300-51600322 CCATGTTGCCTAAAGAATTAGTT 0: 1
1: 0
2: 1
3: 15
4: 201
Right 1174584841 20:51600333-51600355 TCACACTGTCGACACATTTAGGG 0: 1
1: 0
2: 0
3: 7
4: 60
1174584838_1174584842 11 Left 1174584838 20:51600300-51600322 CCATGTTGCCTAAAGAATTAGTT 0: 1
1: 0
2: 1
3: 15
4: 201
Right 1174584842 20:51600334-51600356 CACACTGTCGACACATTTAGGGG 0: 1
1: 0
2: 0
3: 4
4: 42
1174584838_1174584843 22 Left 1174584838 20:51600300-51600322 CCATGTTGCCTAAAGAATTAGTT 0: 1
1: 0
2: 1
3: 15
4: 201
Right 1174584843 20:51600345-51600367 CACATTTAGGGGCCATTCAGTGG 0: 1
1: 0
2: 1
3: 7
4: 161
1174584838_1174584840 9 Left 1174584838 20:51600300-51600322 CCATGTTGCCTAAAGAATTAGTT 0: 1
1: 0
2: 1
3: 15
4: 201
Right 1174584840 20:51600332-51600354 ATCACACTGTCGACACATTTAGG 0: 1
1: 0
2: 0
3: 4
4: 67

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1174584838 Original CRISPR AACTAATTCTTTAGGCAACA TGG (reversed) Exonic
905872139 1:41410885-41410907 ACCTTATTCTGTAGGCAACAAGG + Intergenic
907981032 1:59481139-59481161 AACTATTGCATTAGGCATCAGGG + Intronic
908118848 1:60966658-60966680 AATAAATTTTTTAAGCAACAAGG - Intronic
908489825 1:64632406-64632428 AAATAATACTTAAGACAACAAGG - Intronic
913056629 1:115168021-115168043 CTTTCATTCTTTAGGCAACAGGG - Intergenic
916311938 1:163407480-163407502 AATTCATTCTTTACACAACAGGG - Intergenic
916457006 1:164981412-164981434 AACTCTAGCTTTAGGCAACAAGG + Intergenic
917433627 1:174997589-174997611 AACTAACTCTTAAGGCACAATGG + Intergenic
917486811 1:175462697-175462719 AACTAAGTTTTAAGGCAACAAGG - Intronic
917564103 1:176193977-176193999 AACTAACACTTTTGACAACAAGG + Intronic
918876514 1:190052384-190052406 AACTGATTCTTAAGGCCAGATGG + Intergenic
922682917 1:227615929-227615951 CCCTAATTTTTCAGGCAACACGG + Intronic
923832672 1:237575218-237575240 AACTAAGTTATTAGGCAGCATGG - Intronic
924838014 1:247674441-247674463 AACAAATTATTGAGGCTACAAGG - Intergenic
1064871574 10:19943668-19943690 AAGTATTTCTTTAGGGTACAAGG - Intronic
1072186936 10:93048875-93048897 AAATAATTCTTTTGGCAATTGGG - Intronic
1072270942 10:93775764-93775786 AACTATTTCTTCTGGCAACTTGG + Intronic
1078477566 11:11644652-11644674 GACTAATTTTTTAGATAACAGGG + Intergenic
1078893627 11:15579205-15579227 GAATAATTCTCCAGGCAACAGGG - Intergenic
1080793351 11:35540602-35540624 AAATAATTCTTAAGCCAAAATGG + Intergenic
1081122069 11:39279108-39279130 AACTATTCCTTTCTGCAACAAGG - Intergenic
1082656085 11:55858467-55858489 AAGGTATTCTTAAGGCAACAAGG + Intergenic
1083717989 11:64590253-64590275 AGCTAATTCTGTAGGCGAAAGGG - Intergenic
1084350310 11:68593328-68593350 TACTAATACATTAGACAACATGG - Intronic
1088092787 11:106062908-106062930 AACTAATTCTTTACCTCACAAGG + Intronic
1088386072 11:109257903-109257925 GAATAATGCTTTAGTCAACATGG + Intergenic
1089627000 11:119757680-119757702 ACCTTATTCCTTAGGCAACGGGG - Intergenic
1092027835 12:5257964-5257986 ACCTAAGCCTGTAGGCAACAGGG + Intergenic
1093749130 12:22778746-22778768 AACCAATGCTCTAGGCAACTGGG + Intergenic
1094795132 12:33963256-33963278 AACTGAATCTTTGGCCAACAAGG + Intergenic
1095107764 12:38256352-38256374 AACTGAATCTTTGGCCAACAAGG + Intergenic
1097484619 12:60180202-60180224 AACTAATTCTTTAGGAATTTAGG - Intergenic
1098570362 12:71981333-71981355 ACTTAGTTCTGTAGGCAACAGGG + Intronic
1100288291 12:93188478-93188500 AACTAATCTTTTAGGCAAAGAGG + Intergenic
1101996584 12:109529875-109529897 AGCTAATTCTGTTGCCAACAAGG - Exonic
1103020912 12:117533612-117533634 AACTACTTTATTAGTCAACAAGG + Intronic
1103877270 12:124137941-124137963 ATCTAGTTCTTTAGGTAAGAAGG - Intronic
1105274697 13:18908887-18908909 GACTAATTATTTAGGAAATAGGG + Intergenic
1105387396 13:19944033-19944055 AATTGATTCTTTAGGCAATGGGG + Intergenic
1106375777 13:29186205-29186227 AAAAAATTCTTTTGGAAACAAGG - Intronic
1107270851 13:38614347-38614369 AGCTAATTCTTCAGGAAATATGG + Intergenic
1107608414 13:42086278-42086300 AAGCAACACTTTAGGCAACAAGG - Intronic
1108328331 13:49357803-49357825 ATGTCATTCTGTAGGCAACATGG - Intronic
1110994539 13:82089766-82089788 AACTAATGTTTTATGTAACAAGG - Intergenic
1113202815 13:107886144-107886166 CACTAATTCTTCAGGCTGCAGGG + Intergenic
1114537900 14:23434418-23434440 AACTAGTTCTTGAGGAAAAAGGG - Intronic
1115366721 14:32565958-32565980 AACTCACTCTTTGGGCATCAAGG - Intronic
1115664139 14:35529312-35529334 AACTACATGTTTAGGAAACAGGG - Intergenic
1116694814 14:48159595-48159617 TTCTTATTCTTTAGGCCACAAGG - Intergenic
1117359269 14:54957132-54957154 AACTAATATTTTAGACAATATGG - Exonic
1117839498 14:59844499-59844521 AACTCATTATTTAAGCAAAAGGG - Intronic
1118147179 14:63151653-63151675 AAAGAATTCTTTGGGCAACCAGG + Intergenic
1119922684 14:78460737-78460759 AACTAATTATTGACCCAACAGGG - Intronic
1120116869 14:80628685-80628707 AACACAATCTTTTGGCAACAGGG + Intronic
1120484675 14:85097915-85097937 TACTGATTCTTTAGACATCATGG - Intergenic
1120673686 14:87393671-87393693 AACCAATTCTTGAGGGATCAAGG + Intergenic
1127600863 15:60535363-60535385 AGCAAATTATTTAGGCAATAGGG - Intronic
1128340077 15:66816303-66816325 AAGTCATTGTTTAGGGAACAGGG + Intergenic
1129528414 15:76239838-76239860 AACTGATACTTTTAGCAACATGG - Intronic
1130582120 15:85146941-85146963 AATTAATTAATTAGGAAACAGGG - Intergenic
1130681221 15:85998533-85998555 AGCTAATCCTTTGGGCAACTTGG + Intergenic
1137936675 16:52641533-52641555 AAATCACTCTTTGGGCAACATGG + Intergenic
1138741141 16:59312055-59312077 AATTAGCTCTTTATGCAACAAGG - Intergenic
1140926234 16:79586895-79586917 ATCTAATTCTTTTTCCAACATGG + Intronic
1142174857 16:88640413-88640435 AAATAATTGTTTAAGAAACAGGG - Exonic
1142936253 17:3334610-3334632 AAATAATTCTATAGTCAACCTGG - Intergenic
1146663147 17:34678567-34678589 GCCTAATTCTGTAGGCAATAGGG - Intergenic
1148417752 17:47520657-47520679 ACAAAATTCTTTAGGCAAAAAGG - Intergenic
1148461967 17:47844062-47844084 AAATAATACTTTTGGCAAAAAGG + Intergenic
1149010516 17:51851785-51851807 AAGTAATTCATGAGGAAACATGG - Intronic
1153720690 18:7898885-7898907 AACTACTTCTATAGGAAATATGG + Intronic
1154976462 18:21461982-21462004 ATCTAAACCTTTAGGGAACACGG + Intronic
1157126162 18:44958230-44958252 AACTAACTATTTGGTCAACATGG - Intronic
1157839114 18:50938315-50938337 AAAAAATTTTTTTGGCAACAGGG - Intronic
1158801956 18:60922216-60922238 AACTCATTCCTTAGGCATGAGGG + Intergenic
1159554067 18:69926635-69926657 ATCTAATTCTTCAGGGAACATGG + Intronic
1160000485 18:75015464-75015486 ATATAATTCTTTAGACAACTTGG - Intronic
1167146678 19:47684975-47684997 AACTTATTTTTTTGGAAACAGGG + Intronic
925311260 2:2884058-2884080 AAATAATTCTGTAGTAAACACGG - Intergenic
925517473 2:4699492-4699514 AACTCACTCTTTAGGTAATATGG + Intergenic
926852704 2:17217711-17217733 AATTATTTCTTTATGCAATATGG + Intergenic
927602843 2:24459478-24459500 ATTTAATTCTGTAGGCAACTGGG + Intergenic
928823380 2:35390935-35390957 AACTAAGTTTTTACGGAACAGGG + Intergenic
928939021 2:36708535-36708557 AACTGATCCTTTAGGCAACAGGG - Intronic
930543756 2:52740912-52740934 AACTCATTGTTCAGGCAACGTGG + Intergenic
932232115 2:70091330-70091352 AAATAATGATTTAGGCAGCAAGG + Intergenic
932848743 2:75162317-75162339 AAATATTTCTTTAAGCAAAATGG + Intronic
933224223 2:79726729-79726751 AACTATTTCTTTGGAAAACAAGG + Intronic
933244797 2:79963126-79963148 AACACAATCTTTAGGCAATATGG - Intronic
935815089 2:106839873-106839895 AACTAATTGTTTTGGAAACCTGG - Intronic
938541872 2:132289711-132289733 ATCTCATTCTATAGGCATCATGG - Intergenic
939426565 2:142046023-142046045 AATTAATTCTTAAGCAAACAAGG + Intronic
940162281 2:150726340-150726362 TCCTAATTTTTTAGGCAATATGG + Intergenic
942090076 2:172481212-172481234 AACTACTACTTTAGATAACAGGG - Intronic
942438183 2:176003438-176003460 AACTAAATATTTAGGCAATTAGG - Intergenic
943487167 2:188500554-188500576 AAATAAATCTTTTGGGAACAAGG + Intronic
945412037 2:209521449-209521471 AACTTATTCTTCAGGCATAAAGG + Intronic
945785477 2:214230415-214230437 CACAAATTCTTTTTGCAACAAGG + Intronic
946450684 2:219776471-219776493 AACAAATTCTTAAGGCCATATGG - Intergenic
946890262 2:224268644-224268666 AACATAATCTCTAGGCAACAGGG - Intergenic
947224647 2:227828134-227828156 AAATATTTCTTTAGGCATCCTGG - Intergenic
1171870749 20:30522592-30522614 ACCTCATTCTATAGGCATCATGG - Intergenic
1172418715 20:34795711-34795733 AAATAATTTTTTAGGCAGCTGGG + Intronic
1173104813 20:40123828-40123850 ACTTTATTCTGTAGGCAACAGGG - Intergenic
1174584838 20:51600300-51600322 AACTAATTCTTTAGGCAACATGG - Exonic
1175612589 20:60364052-60364074 ATCTAATTCATTCTGCAACACGG - Intergenic
1176808203 21:13512456-13512478 GACTAATTATTTAGGAAATAGGG - Intergenic
1176965249 21:15205483-15205505 AATTTATTCTGTAGGCAGCAAGG - Intergenic
1177392675 21:20496345-20496367 AACTAGTTCTTTAGGCACACAGG + Intergenic
1177564822 21:22806772-22806794 AATTTATTCTTTAGGCAAGCAGG + Intergenic
1178063391 21:28876303-28876325 AAGTCATTCATTAGGTAACAAGG - Exonic
1178281329 21:31285310-31285332 AACTAAGCCTGTTGGCAACAAGG + Intronic
950007852 3:9703027-9703049 AACAAGTTCTGTAGGCAGCAGGG + Intergenic
951591306 3:24267975-24267997 AAATAATTCTTTAGTCAATTAGG + Intronic
952559647 3:34576359-34576381 AACTATTTCTCTAGGCAGTAGGG - Intergenic
953763903 3:45717987-45718009 AAGTAATTCTTGAAGCAATATGG + Intronic
954014924 3:47679998-47680020 AAAGAATACTCTAGGCAACATGG + Intronic
955950835 3:64240564-64240586 AATTAATTCTGTAGGCCCCATGG - Intronic
958497862 3:94867444-94867466 AACAAATTCTTTGGGCAATATGG + Intergenic
958588585 3:96122843-96122865 AACAATTTATTTTGGCAACAAGG - Intergenic
960321991 3:116248181-116248203 AACTAATTCATTTGGGAGCAGGG + Intronic
963481631 3:145882211-145882233 AACATATTTTTGAGGCAACATGG - Intergenic
964656602 3:159073753-159073775 AATTCATTCTTTAGGCTACAGGG - Intronic
964684120 3:159376206-159376228 CACTAATTATTTATGCAAAAAGG + Intronic
965570879 3:170171565-170171587 AACTAATTTTATAGTCAACATGG + Intronic
965844838 3:172948841-172948863 AACTAATGCTTTTTGCAACGTGG + Intronic
965954900 3:174358106-174358128 AACCAACTGTTTAGGTAACATGG + Intergenic
966098435 3:176236004-176236026 AAGTAATTCTTTAGGAGAAAAGG - Intergenic
968467028 4:757750-757772 TACTAATTCACTAGACAACAGGG - Intronic
970367808 4:15378130-15378152 AGCTAATTCTTTAGCTAACATGG + Intronic
971161561 4:24138745-24138767 AACTGAGTCTGTAGGCTACAGGG - Intergenic
972057077 4:34816346-34816368 AACAAAATCTTTAGGAAATATGG + Intergenic
972154283 4:36139115-36139137 AATTTGTTCTTTAAGCAACATGG - Intronic
972286697 4:37656055-37656077 AACTAATGCTGCAGACAACATGG - Intronic
973375377 4:49282705-49282727 ACCTAATTCTATAGGCATGATGG - Intergenic
973382034 4:49327536-49327558 ACCTAATTCTATAGGCATGATGG + Intergenic
973810274 4:54562658-54562680 AACAAATTCTTTTGAGAACATGG - Intergenic
975919114 4:79362464-79362486 CCCCAATTCTTTAGCCAACAAGG - Intergenic
981102391 4:140843847-140843869 AACTAATTTTTTAGGAGAAAAGG - Intergenic
981264719 4:142768864-142768886 GATTAATTCTACAGGCAACAGGG + Intronic
982738872 4:159037051-159037073 AAGTAATTCTTTAGTAAACAAGG + Intronic
984010990 4:174371352-174371374 AAATAATTCTTGAGGCATCTTGG + Intergenic
984238515 4:177191175-177191197 AACTAATTCTGTTGTTAACAGGG + Intergenic
984665426 4:182422436-182422458 AATTAATTTTTAAGGCAGCAGGG - Intronic
985171142 4:187151606-187151628 CACTAATGCTTTTGGCATCAGGG - Intergenic
986106461 5:4664278-4664300 AAATAATTAATTAGGCACCATGG - Intergenic
986530356 5:8730738-8730760 AAGTAAGTGTTTAGGTAACAAGG - Intergenic
986537111 5:8800949-8800971 AACTAATTTTTTATGTGACATGG - Intergenic
986554460 5:8997574-8997596 AACTAATTTTTTTGGGAACCTGG - Intergenic
990690210 5:58355171-58355193 AACAAATACTTTAGTCAAAATGG - Intergenic
991226133 5:64274914-64274936 CACAAATTCTTTAGTCAATATGG - Intronic
993266110 5:85728530-85728552 AAACAATTCTTTAAGCCACAAGG - Intergenic
995333446 5:110971889-110971911 AAAGAATTCTTCAGTCAACAGGG - Intergenic
995376808 5:111483040-111483062 ATCTATTTCTTAAGGCACCAGGG + Intronic
995726908 5:115190909-115190931 CACTAATTGTTTAGCCATCAGGG - Intergenic
996237201 5:121145664-121145686 AACTAAGTCATAATGCAACAGGG + Intergenic
997031477 5:130134044-130134066 CACTAATTTTTTAAGCAACCTGG + Intronic
1001635541 5:173207543-173207565 AACTCTTTCTTTGGGCAACAAGG - Intergenic
1003879207 6:10465103-10465125 AAATAATTTTCTAGGAAACAGGG - Intergenic
1008454679 6:51695797-51695819 AAAAAATTCTTTATGTAACAGGG + Intronic
1008907064 6:56690175-56690197 AATAAATCCTTAAGGCAACATGG - Intronic
1009633835 6:66237125-66237147 AACTCATTGTTTAGAAAACATGG + Intergenic
1010640153 6:78315647-78315669 CACTAATGCTTAAGGAAACAGGG + Intergenic
1011485173 6:87833565-87833587 ACCTAATACTTTATGCTACAGGG + Intergenic
1012801176 6:103830905-103830927 AACTTATGCTTTACACAACAGGG - Intergenic
1013400731 6:109793993-109794015 AATTCATTCTTCAGGCCACATGG - Intronic
1013584698 6:111567796-111567818 AACTAATGCTTTTTGCAAGAAGG + Intronic
1014885742 6:126779021-126779043 AAATATTTCATTAGGGAACAAGG + Intergenic
1015022676 6:128495370-128495392 AATTCCTTTTTTAGGCAACATGG - Intronic
1015037719 6:128677531-128677553 AACTCCTGCTTTAGGGAACAAGG + Intergenic
1015994547 6:138984787-138984809 AACTAATTGTGTAGGTAACAGGG - Intronic
1016721084 6:147298765-147298787 AAATGATTCTTGAGACAACATGG + Intronic
1017346386 6:153387061-153387083 AACTTATTTTTTCAGCAACATGG + Intergenic
1017728688 6:157295283-157295305 AATTAATTCTTTATGGAAGAGGG - Intronic
1018214850 6:161517113-161517135 AAGTAATTCTATCAGCAACATGG + Intronic
1018533289 6:164791571-164791593 AACTAATTCATTAGTAAAAATGG + Intergenic
1019882255 7:3872508-3872530 AACTAATTCCTTGGGAAAAAAGG - Intronic
1023758072 7:43438782-43438804 ATGTATTTCTTTAGGTAACAGGG + Intronic
1027870537 7:83701282-83701304 AAATAATTTATTAGGAAACAAGG + Intergenic
1027873106 7:83734582-83734604 AATTAATTTTTTTGTCAACAAGG - Intergenic
1030401219 7:109052769-109052791 AACTGACACTTTAGACAACAGGG - Intergenic
1032380196 7:131471381-131471403 AACTAAATATTAAGGCACCAAGG - Intronic
1034291647 7:149937201-149937223 TACAAATTCTTTATGCCACATGG + Intergenic
1038047352 8:23776848-23776870 ATCTTAATCTTTAGGCAATAGGG + Intergenic
1038264075 8:26023569-26023591 AAGTAATTCTTTAGAAAAGAGGG - Intronic
1040894774 8:52354743-52354765 AACTTCTTCATTAGGCATCAGGG - Intronic
1040920915 8:52615864-52615886 AACTCATTCTTTAAGAAACTAGG + Intergenic
1042041279 8:64593142-64593164 AACTTCCACTTTAGGCAACATGG + Intronic
1043259283 8:78177214-78177236 AACTAATTATTTAGGAAAGAGGG - Intergenic
1044083321 8:87911966-87911988 ATATGATTCTATAGGCAACAGGG + Intergenic
1045724357 8:105154524-105154546 ATCTAATTGTTTAGGAAAGATGG + Intronic
1045845423 8:106629473-106629495 ACCAAATTCTTCAGGGAACATGG - Intronic
1046189511 8:110774170-110774192 AAGAAAATCTTGAGGCAACAAGG + Intergenic
1049028710 8:140016057-140016079 TACTAATTCTTGAGGAAAGAAGG - Intronic
1049146202 8:141002212-141002234 AGTTTATTCTTTAGGCAACAGGG + Intronic
1050379732 9:5015089-5015111 AACTATAGCTTTATGCAACATGG - Intronic
1050716816 9:8538050-8538072 AACTAAATACTTAGGCATCAGGG + Intronic
1050751204 9:8940163-8940185 AACTCAGTCTTCAGGCTACATGG + Intronic
1052961225 9:34298677-34298699 AACTAACTTTATAGGCAAGAAGG + Intronic
1053419465 9:37968085-37968107 AAGTACTTCTTTATGCAACATGG + Intronic
1053519332 9:38762352-38762374 TACTATTTCGTTAGGCAAGAGGG - Intergenic
1054827378 9:69586724-69586746 AGTTCATTTTTTAGGCAACAAGG - Intronic
1058628789 9:106964112-106964134 AACTAATGCTGTAGTGAACATGG + Intronic
1061634190 9:131895834-131895856 AACTCTGTCTTTAGTCAACATGG + Intronic
1186648079 X:11528694-11528716 AACAAGATCTTTATGCAACAGGG + Intronic
1187707439 X:22022580-22022602 AACCATTTCTTTAGGAAACTCGG - Intergenic
1188346088 X:29067226-29067248 AATTTAATCTTTATGCAACAGGG - Intronic
1189290425 X:39881295-39881317 GAATAATACTTTAGGCAACGAGG - Intergenic
1190784342 X:53629630-53629652 AACAAACACTTTAGGCAAGAAGG + Intronic
1193855448 X:86596069-86596091 AACTAATACTTGCTGCAACATGG - Intronic
1194577449 X:95629865-95629887 GACTAATTATTTAGGAAAGAGGG + Intergenic
1196613901 X:117744730-117744752 AACAAAGTCTTTAAGAAACACGG + Intergenic
1197339772 X:125252523-125252545 AACTGGTATTTTAGGCAACAGGG - Intergenic
1197406507 X:126059691-126059713 AACAAATTCATAAGGCAAAAAGG + Intergenic
1198727874 X:139696071-139696093 AACTAACTCTTTTGGAAATAAGG + Intronic
1199394323 X:147316870-147316892 AAATAATTATTTGAGCAACATGG + Intergenic
1202339142 Y:23842296-23842318 AAGTAATTCTTGAGGCAAAATGG + Intergenic
1202531624 Y:25827776-25827798 AAGTAATTCTTGAGGCAAAATGG - Intergenic