ID: 1174588075

View in Genome Browser
Species Human (GRCh38)
Location 20:51624183-51624205
Sequence AATTGGGTTTACAAGGAAAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 190
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 175}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1174588068_1174588075 19 Left 1174588068 20:51624141-51624163 CCTTATGACGAACCAGGCCTGTG 0: 1
1: 0
2: 0
3: 6
4: 53
Right 1174588075 20:51624183-51624205 AATTGGGTTTACAAGGAAACAGG 0: 1
1: 0
2: 0
3: 14
4: 175
1174588071_1174588075 -6 Left 1174588071 20:51624166-51624188 CCAAATGCAAGCGACAGAATTGG 0: 1
1: 0
2: 0
3: 7
4: 103
Right 1174588075 20:51624183-51624205 AATTGGGTTTACAAGGAAACAGG 0: 1
1: 0
2: 0
3: 14
4: 175
1174588069_1174588075 7 Left 1174588069 20:51624153-51624175 CCAGGCCTGTGAGCCAAATGCAA 0: 1
1: 0
2: 0
3: 11
4: 172
Right 1174588075 20:51624183-51624205 AATTGGGTTTACAAGGAAACAGG 0: 1
1: 0
2: 0
3: 14
4: 175
1174588070_1174588075 2 Left 1174588070 20:51624158-51624180 CCTGTGAGCCAAATGCAAGCGAC 0: 1
1: 0
2: 0
3: 2
4: 67
Right 1174588075 20:51624183-51624205 AATTGGGTTTACAAGGAAACAGG 0: 1
1: 0
2: 0
3: 14
4: 175

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1174588075 Original CRISPR AATTGGGTTTACAAGGAAAC AGG Intronic
912285965 1:108369633-108369655 CATTGTGTTTCCAAGGAAACAGG - Intergenic
912944138 1:114070581-114070603 TTATGGGTTTAGAAGGAAACAGG + Intergenic
916204436 1:162301524-162301546 AATTGCTTTTACAAGGAGACTGG + Intronic
916314264 1:163430268-163430290 AATAGTGCTTACAAGGAAATTGG - Intergenic
917152780 1:171962688-171962710 AATTAGGTTTAGAAGAAATCAGG - Intronic
919201161 1:194357062-194357084 GATTAGATTTAAAAGGAAACAGG + Intergenic
919251572 1:195063397-195063419 AATTAGGTTTGAAAGGAAAGAGG + Intergenic
920550674 1:206858074-206858096 AATAGGGTTATAAAGGAAACCGG + Intergenic
921108060 1:212002899-212002921 AATCAGGTATACAAGGAAAAAGG + Intronic
921313862 1:213872114-213872136 AATTCGGTTTAAAATGAAAGTGG + Intergenic
922437131 1:225617413-225617435 AATTGGGGTTACTAGGATCCTGG + Intronic
922599736 1:226840800-226840822 AATTTTTTTTTCAAGGAAACAGG + Intergenic
923061777 1:230481996-230482018 AATTGTGTTTTAAAGAAAACTGG + Intergenic
924662670 1:246036130-246036152 AATTGGGTTGAAGAGGAGACAGG + Intronic
1065093863 10:22262245-22262267 AATTTGGTTAACAAGAAAAGTGG + Intergenic
1066313551 10:34221244-34221266 AAATGGGGCTACAAGGAAAGCGG - Intronic
1068861035 10:61848470-61848492 AATTGGGATTACAAGGTCAAAGG - Intergenic
1070745601 10:78931872-78931894 AATTGGTTAAACAAGGAAAAGGG - Intergenic
1071577250 10:86737683-86737705 AATTGTTTTTACAAGAAAGCAGG - Intergenic
1072960550 10:99925301-99925323 AAATGTGTTTCCAAGGTAACTGG - Intronic
1073428994 10:103474003-103474025 AATTAAATTTACAAGGACACAGG - Intronic
1074664489 10:115704325-115704347 AATTGTCTTTATAAGGAAACTGG + Intronic
1078473656 11:11611918-11611940 ATTTGTGTCTACAAGGAACCTGG - Intronic
1078640593 11:13092116-13092138 AATTTGCATTAGAAGGAAACTGG + Intergenic
1078944087 11:16044184-16044206 ATTTGGGTTTCCTGGGAAACAGG - Intronic
1080865049 11:36186593-36186615 AATTAGGAGTACAAGGAATCAGG + Intronic
1083259800 11:61516736-61516758 ATTTGGATTTACAAGGAACGTGG + Intronic
1084775567 11:71372458-71372480 CATTGGGATTACAAGGAGTCTGG + Intergenic
1087981881 11:104624503-104624525 AAAGGGGTTTATAAGGAAAAAGG - Intergenic
1090729019 11:129553734-129553756 ACTTTGGGTTACAAGGAAATTGG + Intergenic
1092012976 12:5131161-5131183 AATTTGGTTAGCAAGGAAAAAGG - Intergenic
1093444660 12:19242977-19242999 CATTGGGTTTAAAATTAAACTGG + Intronic
1093545363 12:20338746-20338768 ACTTGGGTTTAGAAGGAAGGTGG + Intergenic
1096761266 12:53843926-53843948 TATTGGAATTAGAAGGAAACTGG - Intergenic
1099172589 12:79382454-79382476 AATTGAGTTTGCCAGGAAAAAGG + Intronic
1106093807 13:26624304-26624326 AATTGGGTTTATTAGCAAACTGG + Intronic
1109663740 13:65501463-65501485 AATTTGGTTTTAAAGAAAACCGG + Intergenic
1110187819 13:72695195-72695217 AGTTGCCTTTACAAAGAAACAGG + Intergenic
1110475908 13:75913124-75913146 AGATGGGTTTCCAAGGAAAAGGG + Intergenic
1114562126 14:23600951-23600973 AAATGGGTTTACATGTAAAATGG - Intergenic
1115157082 14:30353312-30353334 AATTGGGAATAGAAGGAATCAGG - Intergenic
1115456440 14:33609450-33609472 ATTTGGGTTGAAAAGGAAAAAGG - Intronic
1116453917 14:45095849-45095871 AATTGCGTTTAGAAGAAAAAGGG + Intronic
1117529573 14:56646132-56646154 AATTTGCTTTAAAAGGAAGCTGG + Intronic
1118200863 14:63671427-63671449 AATTTGGTTTAAAAGGAGAGAGG - Intergenic
1118517122 14:66542794-66542816 TACTGGATTTAAAAGGAAACAGG - Intronic
1121138924 14:91523858-91523880 CATTGGGTTTCCCAGGAAAATGG - Intergenic
1121984799 14:98494628-98494650 AATTGGTTCTAGAAGGACACAGG - Intergenic
1122185889 14:99995644-99995666 AATAAGGTATACAAAGAAACAGG - Intronic
1122505196 14:102227517-102227539 AAATGGGTTTAAAAGGAGCCCGG + Intronic
1125897751 15:43316770-43316792 TGTTGTGTTTACAAGGAAATGGG - Intergenic
1127029682 15:54848290-54848312 AATTGGATTTATAAGGAAGATGG - Intergenic
1130734515 15:86534184-86534206 AGTCAGGTCTACAAGGAAACTGG + Intronic
1132648007 16:1007914-1007936 GATGGGGTGTACCAGGAAACGGG - Intergenic
1133799105 16:9070529-9070551 CCTTGGGGTGACAAGGAAACAGG - Intergenic
1134381568 16:13732020-13732042 ATTTGTGTTTACTAGGAAGCAGG + Intergenic
1138994709 16:62435300-62435322 AATGAGGCTTACAAAGAAACAGG + Intergenic
1139000962 16:62509334-62509356 ATTAGGGTATACATGGAAACAGG + Intergenic
1140787103 16:78352867-78352889 TATTGGCTGTACAAAGAAACTGG + Intronic
1144051494 17:11500835-11500857 ACTTGGGTCTACAGGGAAACTGG + Intronic
1144239947 17:13300750-13300772 AAGTGGCCTTACAAGGATACAGG + Intergenic
1146565987 17:33913139-33913161 ATTTGGGCTTACAAGGAGCCGGG + Intronic
1149636941 17:58178567-58178589 AATTGGGTTTACAATACAGCTGG - Intergenic
1149743960 17:59076663-59076685 TTTTGGGTTTACAAAGAAAATGG - Intronic
1151062979 17:71118055-71118077 AATTGCGTTTAAATGGATACAGG - Intergenic
1153680097 18:7492327-7492349 AATTGGTTTTATAAGGGAATTGG + Intergenic
1156334036 18:36152317-36152339 CATTAGGTTGACAAGAAAACAGG - Intronic
1156394621 18:36688139-36688161 AACTGGTTTTACAAGTAGACTGG + Intronic
1157642123 18:49227090-49227112 AATTGAGTTCACAAATAAACAGG + Intronic
1159153737 18:64555061-64555083 AATTTTGTTTACTAGGATACTGG - Intergenic
1159329099 18:66965917-66965939 AATTGGTTTTCCTAAGAAACTGG - Intergenic
1160305788 18:77734372-77734394 AATTAGGTTGACTAGGAAAATGG + Intergenic
1165460910 19:35943882-35943904 AGTTGGGTATAAAATGAAACCGG + Intronic
1167107059 19:47436561-47436583 AATTGTGGTTGCAAAGAAACTGG - Intronic
928064365 2:28148444-28148466 AGTTGGGTTACCAAGGAAACTGG + Intronic
928864153 2:35896631-35896653 AATTGAGTTTACTAAGAAACAGG - Intergenic
930025354 2:47026082-47026104 AATGAGGTCTCCAAGGAAACTGG - Intronic
931075904 2:58711161-58711183 ATGCGGGTTTTCAAGGAAACAGG - Intergenic
931967367 2:67548591-67548613 TATTGTGTTGACAAGGAAAAAGG - Intergenic
933831518 2:86213959-86213981 TGTTGGGCTTAAAAGGAAACAGG - Intergenic
937708928 2:124955723-124955745 AATTGGCTTTTCAATGTAACTGG - Intergenic
937814435 2:126235808-126235830 ACTTGGCTTTAGAAGGAAAAGGG - Intergenic
940597533 2:155814807-155814829 GTTTGGGTTTTCAAGGAAAGAGG - Intergenic
941652056 2:168102436-168102458 TGTTGGGTATACAAGGAAACTGG + Intronic
943496166 2:188623390-188623412 GCTTGGGTTGACAAGGAAGCAGG - Intergenic
945785871 2:214236316-214236338 AATTACTATTACAAGGAAACTGG + Intronic
946403655 2:219481849-219481871 CATTTTGTTGACAAGGAAACAGG + Intronic
1170107682 20:12768936-12768958 AAATGGTCTTAAAAGGAAACAGG - Intergenic
1170968635 20:21099279-21099301 AATTGCGTTTACCAGAAAGCAGG - Intergenic
1172032729 20:31993141-31993163 AAGTGGCTTTCCCAGGAAACTGG - Intronic
1173094394 20:40011034-40011056 AGTTGTGTTTTCAAGGAAAGAGG + Intergenic
1173584528 20:44172261-44172283 AATTGGGGTGAGAAGGAAAAAGG + Intronic
1174163426 20:48567789-48567811 AGTTGGATTCACAAGGAAAAGGG + Intergenic
1174588075 20:51624183-51624205 AATTGGGTTTACAAGGAAACAGG + Intronic
1176018517 20:62951134-62951156 ACCTGGGTTTTCAAGGACACAGG - Intergenic
1177509488 21:22066241-22066263 AATTGGGTTAAGAAGGACATAGG + Intergenic
1177681220 21:24374140-24374162 AATTTTGTATACAGGGAAACTGG - Intergenic
1179339813 21:40495288-40495310 AATTTGGTTTGCTAGGATACGGG - Intronic
1183054501 22:35295312-35295334 AATTGGGAATACAGAGAAACAGG + Exonic
951287247 3:20828285-20828307 AATTGGATGTTCAAGGTAACAGG - Intergenic
951582410 3:24180022-24180044 GAATGGGTTTCCAGGGAAACAGG - Intronic
952725482 3:36579790-36579812 AATTGGGGATACCAGGAACCTGG + Intergenic
955076436 3:55617937-55617959 AATTGTTTTCACAAGGAAACTGG + Intronic
955746858 3:62148947-62148969 AACAAGGTTTACAAGGAAAGAGG - Intronic
960503628 3:118467126-118467148 GATTGGGCTTACAAAGAAAGTGG - Intergenic
963080484 3:141388618-141388640 GATTTGGTTACCAAGGAAACAGG - Intronic
963579000 3:147100254-147100276 AATTGGGTTTACTAAGGAAATGG - Intergenic
964721072 3:159767595-159767617 AATGGGGTATACAATGAAAAGGG + Intronic
965109680 3:164404648-164404670 AACTGGGTTATCAAGGGAACTGG - Intergenic
972162913 4:36247029-36247051 AATTGGCTTTACAAGGATTAAGG + Intergenic
972450770 4:39196124-39196146 AACTGGGTGTCCAAAGAAACAGG - Intronic
974791020 4:66689730-66689752 AATTAGGTTTCTAAAGAAACAGG + Intergenic
977130622 4:93231880-93231902 AGTTGGGTTCTCAAGGAAACAGG - Intronic
979191575 4:117866012-117866034 TATTTGGTTTATAAAGAAACTGG - Intergenic
979403737 4:120283131-120283153 AAATGGCTCTACAAGAAAACAGG + Intergenic
980034721 4:127870814-127870836 AATAGGGTTTTCCAGGAAAAGGG + Intergenic
980861926 4:138509290-138509312 AATTGGGCTTCAAAAGAAACAGG + Intergenic
982587425 4:157260040-157260062 AATTGTCTTTACAAGAAAAAAGG - Intronic
984492444 4:180452447-180452469 AATTGAAATTACAAGGAAATGGG + Intergenic
986273686 5:6255625-6255647 AATTGGGTTTACATCAGAACTGG + Intergenic
989702797 5:44290704-44290726 AATCTGGTTTACAAGTAAAATGG + Intergenic
990826361 5:59903606-59903628 TATTGGGTTTACTATGAACCAGG + Intronic
991996145 5:72389042-72389064 AATGGGGTTCACATGGAAGCAGG + Intergenic
994325861 5:98443788-98443810 AATTGAGTTCCCAAGGAAGCAGG + Intergenic
994652461 5:102545855-102545877 AATTGAGTTTGGAAGGAAGCAGG + Intergenic
995157163 5:108929575-108929597 AATTGGGCTTACAAAGAAGGAGG + Intronic
995324378 5:110873832-110873854 AAATGGGCTTACAAACAAACTGG + Intergenic
996398116 5:123033412-123033434 AACTGGTTTTAAAAGGAAGCTGG + Intronic
998617187 5:143753154-143753176 CATAGAGCTTACAAGGAAACAGG + Intergenic
1000876748 5:166648874-166648896 AATGTGGTTTCCAAGAAAACAGG - Intergenic
1002527746 5:179824246-179824268 AAATGGGTCCACCAGGAAACTGG + Exonic
1004661747 6:17716973-17716995 AATTGTGTTTAAAAGCAAAAGGG - Intergenic
1004766498 6:18734181-18734203 AATTGGTTTTAAATGGACACTGG - Intergenic
1005112922 6:22304434-22304456 AATTGGGTTTCCAAAGAGAGAGG + Intergenic
1005430706 6:25753830-25753852 AATTGGGTGTGAAAGGAAAGGGG + Intergenic
1006529571 6:34639724-34639746 TATGGGGTTCAGAAGGAAACTGG - Intronic
1007097544 6:39223087-39223109 AATTGGTATTACAAAGAATCAGG - Intronic
1008384316 6:50871004-50871026 TTCTGGGTTTAAAAGGAAACGGG - Intergenic
1011466702 6:87665831-87665853 AAATGGTTTTAAAAGGATACTGG - Exonic
1011591877 6:88977721-88977743 ATTTAGGTTTAAAAGGAAGCTGG + Intergenic
1014733381 6:125061395-125061417 TATTCAGTTTACAAGCAAACAGG - Intronic
1016046698 6:139488005-139488027 AATTGGGTTTGCAAAGAAAAGGG + Intergenic
1017442952 6:154480749-154480771 AATCTGGCTTTCAAGGAAACTGG - Intronic
1018264240 6:162004405-162004427 AATTGGATTTATAAGAAAAGAGG - Intronic
1018739635 6:166717512-166717534 AGCTGGGGTTCCAAGGAAACTGG + Intronic
1020351075 7:7218790-7218812 AATTGGGTTTAAAATCAAATTGG + Intronic
1020404497 7:7816706-7816728 AATTGGGTTGAGAATGAAAGAGG - Intronic
1020431247 7:8118589-8118611 ATTTGGGTCTAGAAGGAAAATGG - Intronic
1022922181 7:35026677-35026699 AATGGGCTTTATAAGGAAAAGGG + Intronic
1026288099 7:68981438-68981460 CAAGGGGTTTGCAAGGAAACAGG - Intergenic
1027122786 7:75533934-75533956 CATTGGCTTTCCAAGCAAACTGG - Exonic
1027720795 7:81739166-81739188 AATTGGTTATACTAGGAAATGGG - Intronic
1030946481 7:115728393-115728415 AAGTGGGTTTGAAAGGAAAGGGG - Intergenic
1032729386 7:134622871-134622893 AGTTGCGTTTACAAGGAAATTGG + Intergenic
1033201398 7:139374522-139374544 AGTTGTGTTTAAAAGGAAAAAGG + Intronic
1033664783 7:143430054-143430076 CATTGAGTTTAAGAGGAAACGGG + Intergenic
1033686503 7:143645630-143645652 AATTTGATTAACAAGGAGACAGG - Intronic
1033689234 7:143721685-143721707 AATTTGATTAACAAGGAGACAGG + Intronic
1033698109 7:143811991-143812013 AATTTGATTAACAAGGAGACAGG + Intergenic
1035856913 8:2985812-2985834 AATTTATTCTACAAGGAAACCGG + Intronic
1037493261 8:19415800-19415822 AATTGGATTGAAAGGGAAACAGG - Intronic
1038036242 8:23689247-23689269 AATAAGGTTTACAAGAAAACTGG - Intergenic
1038711475 8:29951019-29951041 AATTTGGTCAACAAGGAGACGGG - Intergenic
1039149353 8:34485953-34485975 AATTTGGTTCAAAAGAAAACTGG - Intergenic
1039919521 8:41883384-41883406 ATGTGGGTTTACAAGGCCACAGG - Intronic
1040124418 8:43720802-43720824 AATTGGTTTTACAAAGAGCCAGG + Intergenic
1040683297 8:49839723-49839745 ATTTGGGTCTACAAGGAATATGG - Intergenic
1042197385 8:66242880-66242902 AAATGAGTTGTCAAGGAAACTGG + Intergenic
1042209157 8:66361209-66361231 AGTTGAGTTTATAAGGAGACAGG - Intergenic
1044025808 8:87170678-87170700 AGCTGGGTATACAAGGAAACTGG - Intronic
1047131640 8:122027020-122027042 TATTGGGTTTACAACAAAAGGGG + Intergenic
1047307581 8:123665425-123665447 AAGTGGGGCTACAAGGAGACTGG + Intergenic
1051676003 9:19558838-19558860 AATTAGGTTTCCTTGGAAACTGG + Intronic
1052204417 9:25821844-25821866 AATGGGGGTTACAAGGGTACTGG - Intergenic
1052541391 9:29816297-29816319 AATTGTGTTTGCATGGAATCAGG + Intergenic
1056019192 9:82423813-82423835 CATTGGGCATATAAGGAAACCGG + Intergenic
1056795375 9:89655375-89655397 AACTGGGCTGTCAAGGAAACAGG - Intergenic
1058572759 9:106365449-106365471 AGGTGGGTTTACAAGGCTACAGG + Intergenic
1185826644 X:3257494-3257516 AAATGGGTTTCCAAAGAAAGTGG - Intergenic
1186455389 X:9706716-9706738 AAATGGGTTTACCAGCAGACTGG - Intronic
1187977564 X:24718640-24718662 AATTGGGTTTACATTTTAACAGG + Intronic
1191900082 X:66031849-66031871 ATTTGGGTTTACAATGAAGTGGG + Intronic
1195671461 X:107473708-107473730 AAATGTGTTCAAAAGGAAACTGG - Intergenic
1196629575 X:117921995-117922017 GTTTGGGTTTACAAAGAAAAAGG - Intronic
1197250971 X:124216234-124216256 GATTGGCTTTAAAATGAAACAGG - Intronic
1197262993 X:124336589-124336611 AATTGGGTTAAAAATAAAACTGG + Intronic
1197780289 X:130152536-130152558 AATGGGATTTGAAAGGAAACAGG + Intronic
1198097991 X:133399328-133399350 GATTGGGTTTACAGGGGCACTGG - Intronic
1199869969 X:151889594-151889616 CATTGTGTTTCCAAGGCAACTGG + Intergenic
1201455765 Y:14165597-14165619 CATGGGGTTTCCAAGGAAGCAGG - Intergenic