ID: 1174588228

View in Genome Browser
Species Human (GRCh38)
Location 20:51625119-51625141
Sequence TGATCTCCCTGCACTGCTGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 199
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 190}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1174588216_1174588228 16 Left 1174588216 20:51625080-51625102 CCTGGTGTCCTCTGCTGCTCCTC 0: 1
1: 0
2: 4
3: 38
4: 392
Right 1174588228 20:51625119-51625141 TGATCTCCCTGCACTGCTGAGGG 0: 1
1: 0
2: 0
3: 8
4: 190
1174588219_1174588228 -6 Left 1174588219 20:51625102-51625124 CCCACCCTTTCCCCCTGTGATCT 0: 1
1: 0
2: 3
3: 46
4: 526
Right 1174588228 20:51625119-51625141 TGATCTCCCTGCACTGCTGAGGG 0: 1
1: 0
2: 0
3: 8
4: 190
1174588221_1174588228 -10 Left 1174588221 20:51625106-51625128 CCCTTTCCCCCTGTGATCTCCCT 0: 1
1: 0
2: 1
3: 32
4: 473
Right 1174588228 20:51625119-51625141 TGATCTCCCTGCACTGCTGAGGG 0: 1
1: 0
2: 0
3: 8
4: 190
1174588218_1174588228 -3 Left 1174588218 20:51625099-51625121 CCTCCCACCCTTTCCCCCTGTGA 0: 1
1: 1
2: 14
3: 75
4: 641
Right 1174588228 20:51625119-51625141 TGATCTCCCTGCACTGCTGAGGG 0: 1
1: 0
2: 0
3: 8
4: 190
1174588217_1174588228 8 Left 1174588217 20:51625088-51625110 CCTCTGCTGCTCCTCCCACCCTT 0: 1
1: 0
2: 9
3: 93
4: 960
Right 1174588228 20:51625119-51625141 TGATCTCCCTGCACTGCTGAGGG 0: 1
1: 0
2: 0
3: 8
4: 190
1174588220_1174588228 -7 Left 1174588220 20:51625103-51625125 CCACCCTTTCCCCCTGTGATCTC 0: 1
1: 0
2: 4
3: 62
4: 1051
Right 1174588228 20:51625119-51625141 TGATCTCCCTGCACTGCTGAGGG 0: 1
1: 0
2: 0
3: 8
4: 190

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1174588228 Original CRISPR TGATCTCCCTGCACTGCTGA GGG Intronic