ID: 1174588997

View in Genome Browser
Species Human (GRCh38)
Location 20:51630327-51630349
Sequence TGCCTAAATTTTGCTACTCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 127
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 121}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1174588995_1174588997 -9 Left 1174588995 20:51630313-51630335 CCATCAATACCTTGTGCCTAAAT 0: 1
1: 0
2: 0
3: 13
4: 122
Right 1174588997 20:51630327-51630349 TGCCTAAATTTTGCTACTCCAGG 0: 1
1: 0
2: 0
3: 5
4: 121

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1174588997 Original CRISPR TGCCTAAATTTTGCTACTCC AGG Intronic
912325407 1:108754427-108754449 AGCCTTGATTTTTCTACTCCTGG + Intronic
918278929 1:182983753-182983775 TGCATGAATTTGACTACTCCAGG + Intergenic
918899785 1:190399841-190399863 CATCTAAATTTAGCTACTCCTGG + Intronic
919659501 1:200229985-200230007 TGCCTAAAATTTCATCCTCCAGG + Intergenic
921319293 1:213922776-213922798 TACCTAAAATTTGCTATTGCTGG + Intergenic
1065029235 10:21568183-21568205 TGCCTAATGTATCCTACTCCTGG - Intronic
1067765768 10:49085016-49085038 TGGGTGACTTTTGCTACTCCAGG - Intronic
1070690932 10:78524897-78524919 TGCTTAAATATTGCTTTTCCAGG + Intergenic
1073558439 10:104476332-104476354 TGCCCAAACTTTGCAACTCAGGG - Intergenic
1077929322 11:6713826-6713848 TGCCTAAATATTGCTATGCTTGG + Intergenic
1079206251 11:18417182-18417204 TGCCTATAAATTGCCACTCCAGG - Intronic
1079641133 11:22806863-22806885 TGCCTCATTTTGGCTACTCTTGG - Intronic
1080704630 11:34678692-34678714 TGCCTTGATTTTCCCACTCCTGG - Intergenic
1083704903 11:64507360-64507382 TGTATAAATTTGGATACTCCAGG + Intergenic
1087022472 11:93617072-93617094 TGCCTTGAATTTGCTATTCCTGG - Intergenic
1099689636 12:85936795-85936817 TACATAAACTTTGCTTCTCCTGG - Intergenic
1103886520 12:124206431-124206453 TGCCTAAAACTGGCTACTTCTGG - Intronic
1105485735 13:20829662-20829684 TTTATAAATTTTGCTACTTCTGG + Intronic
1105618022 13:22038786-22038808 TGGCTAAATTTAGTTATTCCAGG - Intergenic
1112747041 13:102538306-102538328 TGACTAAATTTAGCTACTTTTGG + Intergenic
1114738052 14:25063316-25063338 TGGCTTAATTTTTGTACTCCAGG + Intergenic
1116413267 14:44650124-44650146 TTCCTAAGTTTTCCAACTCCAGG + Intergenic
1116707887 14:48326615-48326637 TGCCTATCTTTTTTTACTCCAGG - Intergenic
1117471616 14:56051694-56051716 TGCCTAACTTTGGATACCCCTGG - Intergenic
1117676477 14:58160077-58160099 AGCCTGAACTTTGCTTCTCCTGG - Intronic
1124266727 15:28242106-28242128 TGTCTGAATTTGACTACTCCAGG - Intronic
1124480661 15:30076359-30076381 TTCCTGTATTTTCCTACTCCAGG + Intergenic
1125343438 15:38696532-38696554 GGCCTATATTTTGCAGCTCCAGG - Intergenic
1125415131 15:39444541-39444563 TGCCCAACTGTTGCCACTCCAGG - Intergenic
1126396981 15:48228806-48228828 TACCTAGACTTTCCTACTCCTGG + Intronic
1128156800 15:65396415-65396437 CCCCTAAATATTGCTCCTCCCGG + Intronic
1129041755 15:72693084-72693106 GGCCTAAATGTTGCTACTACAGG + Intronic
1130079434 15:80719456-80719478 AGCCTAACTTTTACTACTACAGG + Intronic
1130741174 15:86601957-86601979 TTCATAAATTTTGCTTGTCCAGG - Intronic
1136504655 16:30695216-30695238 TGCCTAAATTTTTCAAGGCCAGG + Intergenic
1138903890 16:61306845-61306867 TTCCTTAATTTTCCTACTCTCGG - Intergenic
1139042183 16:63011238-63011260 TTCCTTCATTTTGCTAGTCCTGG - Intergenic
1140633852 16:76887780-76887802 TACTTAAACTTTGTTACTCCAGG + Intergenic
1140991329 16:80214855-80214877 TGCCTTATTTTTGCAACTCCAGG - Intergenic
1145808626 17:27751809-27751831 TGCCTAAATGTCGCTCCTCTGGG + Intergenic
1146875663 17:36408361-36408383 TGCCTAATGTATCCTACTCCTGG - Intronic
1147063724 17:37904508-37904530 TGCCTAATGTATCCTACTCCTGG + Intergenic
1147399184 17:40169286-40169308 TTCCTAACTTTTTCTTCTCCTGG + Intronic
1149184324 17:53979384-53979406 TTCCTAAAGTTTTCAACTCCTGG - Intergenic
1151166754 17:72210270-72210292 TGACTGAATGTTGCTATTCCAGG - Intergenic
1152147252 17:78575760-78575782 TGCCTAAACTTTGGGACTTCAGG - Intronic
1155883406 18:31178288-31178310 TGGCAAAATTTTTCTACTCCAGG - Intergenic
1156239798 18:35241974-35241996 TGCCTAAATATTTTTACTCTTGG + Intronic
1157415229 18:47496787-47496809 TTCCTTAATTTTGCTATTGCAGG - Intergenic
1157630180 18:49087344-49087366 AGACTAAATTTTTCTACTCTAGG + Intronic
1157892348 18:51429565-51429587 TGCCTAAATTTTATTACCCAAGG - Intergenic
1162082244 19:8225131-8225153 TCCCTAAATTATGCCAGTCCTGG - Intronic
1165334692 19:35161282-35161304 TGCCTGAAGTTGGCTACTTCTGG - Intronic
1167532525 19:50026909-50026931 TGCCTAAATTTGCCAACTTCAGG - Intronic
1167774514 19:51545893-51545915 TGCAGAAATTTCCCTACTCCTGG - Intergenic
931940921 2:67251460-67251482 TGCCTAAACTTAGCAACTCAGGG - Intergenic
932683635 2:73849267-73849289 TGGCTTAATGTTGCTCCTCCAGG + Intronic
934926109 2:98382798-98382820 TCCCCAAATTTTACGACTCCAGG - Intronic
938705727 2:133923841-133923863 AGCCCATCTTTTGCTACTCCTGG - Intergenic
939816069 2:146898786-146898808 TTCCAAAATTTAGCTGCTCCTGG + Intergenic
940177139 2:150890866-150890888 TGCATAAATTTGACTACTCTAGG - Intergenic
940687077 2:156865145-156865167 TGCCTGAATTTTGCTAGCACAGG - Intergenic
940940342 2:159552824-159552846 TGCTTAATTTTTATTACTCCAGG - Intronic
942269782 2:174262733-174262755 TGCCTCAATTTAGATAATCCTGG - Intergenic
942949920 2:181710956-181710978 TGACTACTTTGTGCTACTCCAGG + Intergenic
943760821 2:191606822-191606844 TGATCAAATTTTGCTACACCTGG + Intergenic
944096768 2:195976427-195976449 TTCCTAAGGTTTCCTACTCCAGG + Intronic
948718546 2:239881765-239881787 TGGCTAAATTTAGCTTCTCTTGG + Intergenic
1174588997 20:51630327-51630349 TGCCTAAATTTTGCTACTCCAGG + Intronic
1177073499 21:16542500-16542522 ATAATAAATTTTGCTACTCCAGG + Intergenic
1179267420 21:39816740-39816762 TCCATCAATTTTGCTACTACTGG - Intergenic
1179427723 21:41295229-41295251 TACCTCAATTTTCCTACACCTGG - Intergenic
1183462107 22:37957709-37957731 TGTCTGCATTTTTCTACTCCTGG + Intronic
949121671 3:392047-392069 TGACTCAACTTTGCCACTCCAGG - Intronic
949224533 3:1678279-1678301 TGCCTAAATCATTCAACTCCAGG + Intergenic
959158180 3:102692657-102692679 TGCCTAAATTTTCCTGGTCATGG - Intergenic
959417197 3:106089814-106089836 TGCCTGAAATTTGGTAGTCCTGG + Intergenic
959466999 3:106700641-106700663 TTCTTAAATTTTTCTACTGCAGG + Intergenic
959792312 3:110376902-110376924 TGCCTAAATTTTGCTTTTAAAGG + Intergenic
961048202 3:123724106-123724128 TGGCTAAGTTTTGCTAAGCCTGG + Intronic
961864581 3:129944498-129944520 TGCTTAAATGTTCCTCCTCCTGG - Intergenic
964877884 3:161389983-161390005 TTCCTAAATTTTGATATTCTAGG - Intergenic
969549454 4:7854949-7854971 TGCCTAAGTTCTGGTTCTCCTGG - Intronic
971777117 4:30980453-30980475 AGACTAAATTTTGCTAATCAGGG - Intronic
972064890 4:34929227-34929249 TGCCTCAGTTTTGATACTCTGGG + Intergenic
974223674 4:59010242-59010264 TGCCTACATTTTTCTACTGATGG + Intergenic
974270532 4:59646038-59646060 TGCCTAAAAAATGCTACTCCAGG + Intergenic
978892342 4:113845216-113845238 GGACTTAATTTTTCTACTCCTGG - Intergenic
980717989 4:136653171-136653193 TTCCTAAACTTTGTCACTCCAGG - Intergenic
983162529 4:164433970-164433992 TGCCTAAACTTTTTTACTACTGG - Intergenic
983975897 4:173934025-173934047 TGCCTTATTTTGGCTACACCTGG - Intergenic
987429899 5:17820081-17820103 TGGCTAAACTTTCCTACTTCTGG + Intergenic
989458486 5:41669102-41669124 TGCTTAAATGTTGCTACCCCAGG - Intergenic
990666937 5:58083047-58083069 TTCCTAAATGTTGCATCTCCTGG + Intergenic
994852905 5:105078986-105079008 TTCCTAAAGTTTGCTTCTTCGGG + Intergenic
995819599 5:116214717-116214739 GGCCTCAATTTTGGGACTCCAGG + Intronic
997381134 5:133439343-133439365 TGCCAATATTTGGTTACTCCTGG + Intronic
1001800609 5:174540817-174540839 TCCCTGAATTTGACTACTCCAGG - Intergenic
1007179495 6:39918955-39918977 TGCCTAGATTGTGTTTCTCCGGG - Intronic
1011586372 6:88930680-88930702 TTCCTAAAATCTGCTGCTCCTGG - Intronic
1012047828 6:94301164-94301186 TGCCTAAGATTTCCAACTCCGGG + Intergenic
1013140661 6:107330883-107330905 AGCCTAAATTCTGCCTCTCCTGG + Intronic
1014589718 6:123248697-123248719 TGACTAAATTTTGCTACAGTTGG - Intronic
1014791678 6:125679452-125679474 TGCCTGACTTTTGCAGCTCCAGG + Intergenic
1015968175 6:138716158-138716180 TGCCTAAATGTTGCTAGACTGGG + Intergenic
1016272960 6:142311658-142311680 TGACTAATTTTTGCTTCTCTAGG + Intronic
1022074157 7:26949822-26949844 TGCCTTAATTATGATCCTCCAGG - Intronic
1022197880 7:28086608-28086630 TGCATCAATTTTACTACTCAGGG - Intronic
1030977835 7:116148763-116148785 TGACTAAATTGTGCAACTTCTGG - Intronic
1031546115 7:123053146-123053168 CTCCTAAATTTTTCAACTCCAGG - Intergenic
1032556349 7:132839396-132839418 TGGATAAATTTTGCTGCCCCAGG - Intronic
1034313995 7:150112811-150112833 TGCCCCAATTTAGCTCCTCCTGG + Intergenic
1034792904 7:153987981-153988003 TGCCCCAATTTAGCTCCTCCTGG - Intronic
1035281154 7:157779296-157779318 GGCCTAACTGTTGCTACTCTTGG + Intronic
1036596396 8:10216622-10216644 TGTCTAAATTTGACTACTCTAGG + Intronic
1044920881 8:97168104-97168126 TTCCTAAATTTTGCACATCCTGG - Intergenic
1050851875 9:10298024-10298046 TGCATATATTTTGTTACTCTTGG - Intronic
1054848042 9:69817763-69817785 TGCCTACATTTTTCTGATCCAGG + Intergenic
1056561310 9:87732375-87732397 TCCCCAAATCTTGCTACCCCTGG - Intergenic
1058523851 9:105837951-105837973 TGCCTATATCCTCCTACTCCAGG + Intergenic
1059789691 9:117627398-117627420 TGCCTAAATTAAGTTATTCCTGG - Intergenic
1061660048 9:132124035-132124057 TGCCCAAAATGTGCTACACCTGG + Intergenic
1186023373 X:5281896-5281918 TCCCTGAATTTGGCGACTCCAGG - Intergenic
1186092006 X:6059943-6059965 TGCCTTCATTTTACTACTCTTGG + Intronic
1187973355 X:24680893-24680915 TCTGTAAATTTTACTACTCCAGG - Intergenic
1189415612 X:40810076-40810098 TGCCTAAATTTTCCTCATCGTGG + Intergenic
1196852053 X:119947110-119947132 TGCCTAACTTTTGCGACAACAGG + Intergenic