ID: 1174591410

View in Genome Browser
Species Human (GRCh38)
Location 20:51648161-51648183
Sequence CAGGCTATACCCAGGCATGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 436
Summary {0: 1, 1: 0, 2: 0, 3: 38, 4: 397}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1174591407_1174591410 -8 Left 1174591407 20:51648146-51648168 CCTGAGGCTGAGGCTCAGGCTAT 0: 1
1: 0
2: 1
3: 31
4: 238
Right 1174591410 20:51648161-51648183 CAGGCTATACCCAGGCATGGAGG 0: 1
1: 0
2: 0
3: 38
4: 397

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1174591410 Original CRISPR CAGGCTATACCCAGGCATGG AGG Intronic
900229546 1:1549549-1549571 AAGGCTGCAGCCAGGCATGGTGG + Intronic
900679472 1:3908755-3908777 CAGGCTGTACAGGGGCATGGTGG + Intergenic
900777293 1:4594618-4594640 CAGGCAGAACCCAGGCGTGGGGG - Intergenic
901034113 1:6326040-6326062 CAGGGTCTCCCAAGGCATGGTGG + Intronic
901289735 1:8114562-8114584 CAGGCATTGGCCAGGCATGGTGG + Intergenic
901473870 1:9475750-9475772 CAGGGTAGTTCCAGGCATGGTGG - Intergenic
902210900 1:14903674-14903696 AAGCCTGTACCCAGGGATGGTGG - Intronic
902327160 1:15708708-15708730 TAGACTCTAGCCAGGCATGGTGG - Intronic
902408272 1:16198434-16198456 CAGGCTGGACACAGGAATGGGGG - Exonic
903330893 1:22596585-22596607 GAGGCTGCACCCAGGCCTGGTGG - Intronic
904062221 1:27720669-27720691 CATGATATGGCCAGGCATGGTGG - Intergenic
904501466 1:30915180-30915202 CAGTTTATTCCCAGGCACGGGGG - Intergenic
904617865 1:31759746-31759768 CTGGCTATACACAGGCAGGAGGG - Intronic
904789038 1:33004471-33004493 CATTCTTTACCCAGACATGGTGG + Intergenic
905021824 1:34821805-34821827 CAGACTGTAACCAGGCATAGTGG + Intronic
905332539 1:37216160-37216182 CACACTGTAGCCAGGCATGGTGG + Intergenic
905686167 1:39910192-39910214 CAGAGTAGAGCCAGGCATGGTGG + Intergenic
905711988 1:40113027-40113049 CAAACATTACCCAGGCATGGTGG + Intergenic
906432274 1:45765007-45765029 GAAGAAATACCCAGGCATGGTGG - Intergenic
906528381 1:46509567-46509589 AAGGCTATACCCCAGGATGGAGG + Intronic
907007386 1:50928930-50928952 AAAGAAATACCCAGGCATGGTGG + Intronic
907069570 1:51521583-51521605 CACACCTTACCCAGGCATGGTGG + Intergenic
907340336 1:53730999-53731021 TATTCTATAACCAGGCATGGTGG + Intronic
907702484 1:56802536-56802558 CAGCATAGACACAGGCATGGAGG + Intronic
909753220 1:79190604-79190626 CTGACTGTCCCCAGGCATGGTGG - Intergenic
912650288 1:111432665-111432687 CAGTCTATACCCAAGGATGCAGG - Intergenic
913649029 1:120892127-120892149 CTGGATACAGCCAGGCATGGTGG + Intergenic
914077677 1:144371395-144371417 CTGGATACAGCCAGGCATGGTGG - Intergenic
914101502 1:144595110-144595132 CTGGATACAGCCAGGCATGGTGG + Intergenic
914172586 1:145239935-145239957 CTGGATACAGCCAGGCATGGTGG - Intergenic
914297463 1:146342387-146342409 CTGGATACAGCCAGGCATGGTGG - Intergenic
914527231 1:148480929-148480951 CTGGATACAGCCAGGCATGGTGG - Exonic
914639165 1:149586204-149586226 CTGGATACAGCCAGGCATGGTGG + Intergenic
915424153 1:155810418-155810440 CTGGCTAAGGCCAGGCATGGTGG + Intronic
917183436 1:172323966-172323988 CAGGCAACACACAGGAATGGTGG + Intronic
918647908 1:186923153-186923175 CAGGATTTGGCCAGGCATGGTGG - Intronic
918656274 1:187029722-187029744 CAGAGTGTAGCCAGGCATGGTGG + Intergenic
920329920 1:205199589-205199611 TAGGCCATTCCCAGGCTTGGAGG - Intronic
920371949 1:205484716-205484738 CCAGCTATGACCAGGCATGGTGG + Intergenic
921129456 1:212207396-212207418 CTGGATATAGCCAGGCGTGGTGG + Intergenic
921505753 1:215967452-215967474 CAGTTTATGGCCAGGCATGGTGG - Intronic
922962818 1:229662865-229662887 CAGGCTATAGCCTGGCATGCCGG - Intergenic
924175170 1:241384223-241384245 CAGGGTCTGGCCAGGCATGGTGG + Intergenic
924347316 1:243084673-243084695 CAGGCTATATGCAGGGATGCAGG + Intergenic
924469769 1:244332408-244332430 AAGGTTTTAGCCAGGCATGGTGG + Intergenic
1063409905 10:5829485-5829507 CAGCCAATGGCCAGGCATGGTGG + Intronic
1063650337 10:7929912-7929934 CAGGCTAGGGCCAGGCGTGGTGG + Intronic
1064246168 10:13669210-13669232 CAGACATTAGCCAGGCATGGTGG - Intronic
1067108181 10:43379379-43379401 CAGGCTATTGCCAGGCACAGTGG + Intergenic
1068748743 10:60566581-60566603 CAGCCACTAGCCAGGCATGGTGG + Intronic
1070198913 10:74184481-74184503 CAAAATATAGCCAGGCATGGTGG - Intronic
1070560120 10:77559888-77559910 CAGGTTATGGCCAGGCATGGTGG + Intronic
1071266596 10:83970098-83970120 CAGGCATGAGCCAGGCATGGTGG - Intergenic
1071963749 10:90832276-90832298 TAGGGGAGACCCAGGCATGGTGG + Intronic
1072132671 10:92511388-92511410 CAGGTTTTGGCCAGGCATGGTGG - Intronic
1072271842 10:93784256-93784278 CAGGCTTTTCCAGGGCATGGAGG - Intronic
1072548847 10:96461600-96461622 GAGGCTAAACAAAGGCATGGAGG - Intronic
1072653964 10:97318025-97318047 CAACCTATAGCCAGGCGTGGTGG + Intergenic
1072922596 10:99589008-99589030 CAAGCATTAGCCAGGCATGGTGG + Intergenic
1073813303 10:107175586-107175608 CAAGCATTAGCCAGGCATGGTGG - Intergenic
1075501131 10:122974988-122975010 CAGGGTGTAGCCAGGCATGGTGG - Intronic
1076294004 10:129369831-129369853 CAGGCTCTGCCCAGCCAGGGTGG + Intergenic
1077669056 11:4141059-4141081 CAAAATATAGCCAGGCATGGTGG - Intergenic
1079231461 11:18652576-18652598 CTCCCTATAGCCAGGCATGGTGG - Intergenic
1079338878 11:19595847-19595869 CAGGCTCTGGCCAGGCATGGTGG - Intronic
1079492964 11:21010018-21010040 CTGGCTTAACCCAGGAATGGTGG + Intronic
1081556320 11:44165329-44165351 CAGGCTATACTAAGCCCTGGAGG + Intronic
1083769435 11:64858159-64858181 TAGGCTCTGGCCAGGCATGGTGG - Intronic
1083769488 11:64858473-64858495 TAGGCTCCAGCCAGGCATGGTGG - Intronic
1083781628 11:64921398-64921420 CAGGCTTTGCCCAGGCCGGGGGG + Intronic
1084025790 11:66448466-66448488 ATGGCAAAACCCAGGCATGGTGG - Intronic
1084635775 11:70391527-70391549 CCGGCCATAGCCAGGCGTGGTGG - Intergenic
1084754191 11:71224409-71224431 CAGGCTAGACCCAGTCAGGGTGG - Intronic
1085370242 11:75996601-75996623 CAGTTTATACAGAGGCATGGAGG + Intronic
1085978408 11:81691171-81691193 TAGGTTATACCAAGGCATGCTGG + Intergenic
1087074488 11:94116746-94116768 CAGGCGTTAGCCAGGCATGGTGG - Intergenic
1087840564 11:102916839-102916861 CAAAATATAGCCAGGCATGGGGG + Intergenic
1089076075 11:115739892-115739914 CAGGCCCTACAAAGGCATGGTGG - Intergenic
1089715721 11:120357279-120357301 CAGGCTGGGGCCAGGCATGGTGG - Intronic
1090636964 11:128695168-128695190 CAACCTAGACCCAGGCTTGGCGG - Intronic
1091491148 12:933832-933854 CAGGTAATGGCCAGGCATGGTGG + Intronic
1091506689 12:1076545-1076567 CAGGAATTAGCCAGGCATGGTGG - Intronic
1091842958 12:3633613-3633635 CCGGTTCTCCCCAGGCATGGCGG - Exonic
1092150921 12:6247886-6247908 CAGGCCAGAGCCAGGCGTGGTGG + Intergenic
1092736658 12:11588993-11589015 CAGCATATGGCCAGGCATGGTGG - Intergenic
1092821966 12:12361006-12361028 CAGGCTGGAGCCAGGCACGGTGG - Intronic
1093683449 12:22029983-22030005 CAGATTAAAGCCAGGCATGGTGG + Intergenic
1094035572 12:26066787-26066809 CTGGCTCTACCCAGGCTGGGTGG - Intronic
1094224012 12:28025715-28025737 CAGACATTAGCCAGGCATGGTGG + Intergenic
1094611689 12:32000987-32001009 CAGGATACAGCCAGGCATGGTGG - Intergenic
1095583119 12:43822742-43822764 GTGGCAATAGCCAGGCATGGTGG + Intergenic
1096055978 12:48652366-48652388 CAAAATATAACCAGGCATGGTGG + Intergenic
1096394851 12:51258012-51258034 AAAGCAATAGCCAGGCATGGTGG + Intronic
1097205502 12:57317470-57317492 CAGGCTCCAGCCAGTCATGGTGG - Intronic
1097220180 12:57444967-57444989 CAGGCTTCAGCCAGGCGTGGTGG - Intronic
1100178611 12:92059356-92059378 CAGGTTACAGCCAGGCACGGTGG - Intronic
1101246119 12:102885682-102885704 CAGGCTCTGGCCAGGCCTGGGGG - Intronic
1102175985 12:110875071-110875093 CAGGCTTTGAGCAGGCATGGTGG + Intronic
1102269802 12:111523434-111523456 AATGCTATGGCCAGGCATGGTGG + Intronic
1102393329 12:112567336-112567358 CATGCTTTGTCCAGGCATGGTGG + Intergenic
1102523808 12:113496677-113496699 CAGGAGAAGCCCAGGCATGGGGG - Intergenic
1102567201 12:113804539-113804561 CAGGCCCTGGCCAGGCATGGTGG - Intergenic
1102656104 12:114483677-114483699 CAGGCCACAGCCATGCATGGGGG + Intergenic
1102707376 12:114893889-114893911 CAGGCTATAGCTGGGCATGCTGG + Intergenic
1102926294 12:116828851-116828873 CAGGTTAAGGCCAGGCATGGTGG + Intronic
1103445287 12:120990451-120990473 AAGGAAATAGCCAGGCATGGTGG + Intronic
1103535433 12:121630485-121630507 CTGGCTTCAGCCAGGCATGGTGG - Intronic
1104050833 12:125192629-125192651 CAGGTTTCAGCCAGGCATGGTGG - Intronic
1104416964 12:128603512-128603534 CAGACTAAACACAGGCATGGAGG - Intronic
1105068163 12:133217623-133217645 CTGGCAATCCCCAGGCCTGGAGG - Intergenic
1105520045 13:21123512-21123534 CAAACAATAGCCAGGCATGGTGG - Intergenic
1105574574 13:21638117-21638139 CAGGCTGGCCCCAGGCATTGAGG + Intergenic
1106570504 13:30923206-30923228 CAGGCTGTGGCCAGGCGTGGTGG - Intronic
1106931538 13:34670966-34670988 CAGCCTCAGCCCAGGCATGGAGG + Intergenic
1107697218 13:43012001-43012023 CAACCTAAAGCCAGGCATGGTGG - Intergenic
1107822586 13:44299766-44299788 CTGGCTGTACCCAGGGATGGAGG - Intergenic
1107886952 13:44881555-44881577 GAGGCTATACCCATGCAGTGTGG + Intergenic
1110741947 13:79008019-79008041 CAGGTGATACCAAAGCATGGTGG - Intergenic
1110809804 13:79799559-79799581 CAGGCATTACCCACACATGGTGG - Intergenic
1111355813 13:87101526-87101548 TAAGTAATACCCAGGCATGGAGG - Intergenic
1112037805 13:95513968-95513990 CAGCCTATTACCAGGCATGGTGG + Intronic
1112974006 13:105294546-105294568 CAGGATATGTCCGGGCATGGTGG + Intergenic
1113582094 13:111437135-111437157 CATCCTATAGCCAGGCCTGGAGG - Intergenic
1116444399 14:44991948-44991970 AAGTTTATAGCCAGGCATGGTGG + Intronic
1117067819 14:52027874-52027896 CACTCTTTAGCCAGGCATGGTGG - Intronic
1117264012 14:54066782-54066804 CAGGCTGTACCCAAGCTTGTTGG - Intergenic
1117369279 14:55061796-55061818 GATGCTTTAACCAGGCATGGTGG + Intronic
1117375358 14:55113946-55113968 CCAGCTTTAGCCAGGCATGGTGG - Intergenic
1118248945 14:64139562-64139584 CAGAAAATACCCAGGCATGGTGG - Intronic
1118628175 14:67677847-67677869 CAGGGCTTGCCCAGGCATGGTGG - Exonic
1119437967 14:74610595-74610617 CCTGCCATACCCAGGCAAGGCGG + Intronic
1119986013 14:79138304-79138326 AAGGCATTAGCCAGGCATGGTGG - Intronic
1120122245 14:80695426-80695448 CAGGGTGTGGCCAGGCATGGTGG + Intronic
1120800195 14:88679402-88679424 GGGGCTATAGCCAGGCATGGTGG + Intronic
1121086989 14:91154191-91154213 CAAGCTGTGGCCAGGCATGGTGG - Intronic
1121329820 14:93042863-93042885 CAAGAATTACCCAGGCATGGTGG + Intronic
1121455169 14:94034195-94034217 CAGGCAATATCCAGACACGGTGG - Intronic
1121602519 14:95216542-95216564 CATGCTAAATCCAGGCGTGGTGG - Intronic
1125816715 15:42591333-42591355 CAGAAAATAGCCAGGCATGGTGG + Intronic
1126320411 15:47416308-47416330 CAGACCATACCCAGGCTTGAAGG - Intronic
1128281693 15:66399880-66399902 TGGGCGATAGCCAGGCATGGTGG - Intronic
1129395039 15:75239440-75239462 TAGGGTATGGCCAGGCATGGTGG - Intergenic
1129764247 15:78151286-78151308 CAGGTTGTGGCCAGGCATGGTGG + Intronic
1129778892 15:78256145-78256167 CAGGCTCTGGCCAGGCATGGTGG - Intergenic
1130637514 15:85638910-85638932 CAAAATTTACCCAGGCATGGTGG - Intronic
1131287258 15:91070910-91070932 CAGTCTTCAGCCAGGCATGGTGG + Intergenic
1131303650 15:91222029-91222051 AAGGCTATGCAGAGGCATGGAGG - Intronic
1131612689 15:93981726-93981748 CAGGACATGGCCAGGCATGGTGG - Intergenic
1132084316 15:98894614-98894636 CAGATTATAGCCAGGCACGGCGG + Intronic
1132703564 16:1231748-1231770 CAGGCTGGTCCCAGGCAGGGTGG - Intergenic
1132704946 16:1239613-1239635 CAGGCTGGTCCCAGGCAGGGTGG + Intergenic
1132707953 16:1254647-1254669 CAGGCTGGTCCCAGGCAGGGTGG + Intergenic
1133515703 16:6506797-6506819 CAGAAAATAGCCAGGCATGGTGG - Intronic
1133585476 16:7190206-7190228 CAGAAATTACCCAGGCATGGTGG + Intronic
1134455155 16:14390026-14390048 GATGCTATAGCCAGACATGGTGG - Intergenic
1135524824 16:23206241-23206263 CAAGCTATTCCCAGACAAGGTGG - Intronic
1135537504 16:23305363-23305385 CTGGCAATGGCCAGGCATGGTGG + Intronic
1135594990 16:23734991-23735013 AAGCCTCTAGCCAGGCATGGTGG - Intergenic
1137018101 16:35395471-35395493 CTGGCCATAGCCAGGCGTGGTGG + Intergenic
1137958992 16:52862596-52862618 CAGCCTGTAGCCAGGCATGGTGG - Intergenic
1138045481 16:53719382-53719404 TAGACAATAGCCAGGCATGGTGG - Intronic
1139539086 16:67600389-67600411 CAAAATATAGCCAGGCATGGTGG - Intronic
1140398851 16:74653184-74653206 CACAATATAGCCAGGCATGGTGG + Intronic
1141487304 16:84349253-84349275 CAGACTGTGGCCAGGCATGGTGG + Intergenic
1142070807 16:88090556-88090578 CAGGCACTACCCAGCCATGCCGG + Intronic
1142281173 16:89148451-89148473 CAGGCTACACTGATGCATGGAGG + Intronic
1142344135 16:89543232-89543254 CAGGATATAGCCAGGCGCGGTGG - Intronic
1143098435 17:4490998-4491020 CAGGTATTATCCAGGCATGGAGG + Intergenic
1145251272 17:21298193-21298215 CAGGACAGACCCAGGCCTGGAGG - Intronic
1145273170 17:21415290-21415312 CAGGCTAGCTCCAGGCAGGGCGG - Exonic
1145311363 17:21702734-21702756 CAGGCTAGCTCCAGGCAGGGCGG - Exonic
1146276345 17:31518203-31518225 CAGGTTGTGGCCAGGCATGGTGG + Intronic
1147845853 17:43403455-43403477 CAGAAATTACCCAGGCATGGTGG - Intergenic
1148054289 17:44784672-44784694 CAGGCATTAGCCAGGCGTGGTGG - Intergenic
1148857207 17:50585296-50585318 GGAGCTATAGCCAGGCATGGTGG - Intronic
1148880963 17:50726800-50726822 CAGTATATAGCCAGGCACGGTGG + Intronic
1148913018 17:50953391-50953413 CAAGGAAAACCCAGGCATGGTGG + Intergenic
1148930998 17:51127249-51127271 AAGGCTTTGGCCAGGCATGGTGG - Intergenic
1149152548 17:53585977-53585999 CAAACATTACCCAGGCATGGTGG + Intergenic
1149754005 17:59172784-59172806 CAGGGAAGACTCAGGCATGGCGG - Intronic
1149829187 17:59856251-59856273 CTGGCTTTAGCCAGGCACGGTGG - Intergenic
1149897308 17:60438379-60438401 CAGGCTATGGCCAGGCTTGGTGG + Intergenic
1150853619 17:68729585-68729607 CAGGCTGAGGCCAGGCATGGTGG + Intergenic
1150899384 17:69254664-69254686 AAAGCAATAGCCAGGCATGGTGG - Intronic
1151818875 17:76486260-76486282 CAAACATTACCCAGGCATGGTGG - Intronic
1152462283 17:80447847-80447869 CAGGCTAAGGCCAGGCACGGTGG - Intergenic
1154929607 18:20979214-20979236 CAGGTTATGGCCGGGCATGGTGG - Intronic
1155141175 18:23045962-23045984 CAGGCTGAAACCAGCCATGGTGG - Intergenic
1155771106 18:29701005-29701027 CTGGCATTTCCCAGGCATGGAGG - Intergenic
1156614391 18:38766381-38766403 CAGGCTGTAACCAGGGCTGGGGG + Intergenic
1157086580 18:44586514-44586536 CAGTGTAGAGCCAGGCATGGTGG + Intergenic
1157663389 18:49465508-49465530 CAGGCAATACCCAGGAATGCTGG - Intergenic
1160096828 18:75881077-75881099 CAGCCAATAACCTGGCATGGAGG + Intergenic
1160406125 18:78647396-78647418 GAGCCTCTGCCCAGGCATGGAGG - Intergenic
1160830032 19:1099742-1099764 CAGCCCATAGCCGGGCATGGTGG + Intergenic
1161850376 19:6735031-6735053 CAGGAATTAGCCAGGCATGGTGG - Intronic
1162443377 19:10707243-10707265 CAGGCTTTCCCCAAGCATTGCGG + Intronic
1162819805 19:13215767-13215789 CAGGTGATAGCCAGGCATGGTGG - Intronic
1163339887 19:16698857-16698879 CAGGGTTTGGCCAGGCATGGTGG - Intergenic
1163595014 19:18216189-18216211 CTGGCTGTACCCAGGCAATGTGG - Intronic
1164866554 19:31609143-31609165 CAGGATAGATCCAGGTATGGAGG + Intergenic
1165025110 19:32954950-32954972 CAGGCTGGGGCCAGGCATGGTGG - Intronic
1166196711 19:41211115-41211137 TGGGCTATAGCCGGGCATGGTGG + Intergenic
1167051628 19:47082598-47082620 CAGGAAGTACCCAGGCTTGGTGG - Intronic
1167428354 19:49441210-49441232 CGGGCGATACCCCGGCATGGGGG - Intronic
1167481551 19:49735046-49735068 AAGGCTTTAGCCAGGCATAGAGG + Intergenic
1168329186 19:55556483-55556505 TGGCCTATAGCCAGGCATGGTGG + Intergenic
1168482147 19:56729968-56729990 GAGTATATACCCGGGCATGGTGG + Intergenic
925989366 2:9241570-9241592 CATCTTTTACCCAGGCATGGTGG + Intronic
926104756 2:10143158-10143180 CAGGCTCAGGCCAGGCATGGTGG - Intronic
926750207 2:16192736-16192758 CAGGCTTTTGCCAGGCATGGTGG - Intergenic
927654826 2:24936325-24936347 GAGGGCTTACCCAGGCATGGTGG + Intergenic
927689149 2:25195329-25195351 CAAGCCACAGCCAGGCATGGTGG + Intergenic
928554051 2:32404465-32404487 CAAAATTTACCCAGGCATGGTGG - Intronic
930153607 2:48082556-48082578 TAGGAAATAGCCAGGCATGGTGG + Intergenic
932414917 2:71567849-71567871 CCTGCTCTACCCAGGCTTGGAGG + Intronic
933803113 2:85978664-85978686 CAAGCAAAAGCCAGGCATGGGGG + Intergenic
934018525 2:87917574-87917596 GAGGCTATAGCAAGACATGGTGG + Intergenic
934315596 2:91915961-91915983 GAGGCTTTGGCCAGGCATGGTGG - Intergenic
936409762 2:112247285-112247307 TAAGCTATAGCCAGCCATGGTGG + Intronic
936411640 2:112263397-112263419 TACGCAATAGCCAGGCATGGTGG + Intergenic
936464512 2:112735194-112735216 CAGGCGTTATCCAGGCGTGGGGG - Intronic
937129263 2:119495090-119495112 AAATCTATATCCAGGCATGGTGG - Intronic
937552519 2:123112335-123112357 CAATCTATGCCCAGGAATGGTGG - Intergenic
937628974 2:124077667-124077689 CAGCCTAAACACAGGCATGATGG - Intronic
938078571 2:128355647-128355669 CAGAAATTACCCAGGCATGGTGG - Intergenic
938646698 2:133338718-133338740 AAGGCCATGGCCAGGCATGGTGG + Intronic
938888008 2:135673158-135673180 CATGATGTAACCAGGCATGGTGG + Intronic
940421618 2:153485745-153485767 AAGGCTTTAGCCGGGCATGGTGG + Intergenic
941876607 2:170439965-170439987 GAAACTATAGCCAGGCATGGTGG - Intronic
942826728 2:180186853-180186875 CAAGTTTTAGCCAGGCATGGTGG + Intergenic
943670917 2:190659486-190659508 CAGGATATTCCCAGCCATGTTGG - Exonic
944144066 2:196486994-196487016 CAGGCATGAGCCAGGCATGGTGG + Intronic
946624614 2:221597137-221597159 CAGTATATAGCCAGGCATGATGG - Intergenic
947476660 2:230455349-230455371 CATGATAAAACCAGGCATGGTGG - Intronic
948174747 2:235934352-235934374 CAGGCTCCACCCAGGCCTGCTGG + Intronic
948711804 2:239829797-239829819 CAGGCTGGACCCAGGCCTGCAGG - Intergenic
1169891493 20:10457963-10457985 CAGGCCCTGGCCAGGCATGGTGG - Intronic
1172393856 20:34585120-34585142 CAGGCGGTGGCCAGGCATGGTGG - Intronic
1172467468 20:35166772-35166794 CATTCTAAACCCAGGGATGGGGG - Intergenic
1172647639 20:36481159-36481181 CAGGCTAGACACAGGCAGGATGG - Intronic
1174210511 20:48874587-48874609 CAGGATGTGGCCAGGCATGGTGG + Intergenic
1174344536 20:49920278-49920300 CATGCTTCATCCAGGCATGGTGG + Intergenic
1174591410 20:51648161-51648183 CAGGCTATACCCAGGCATGGAGG + Intronic
1175070580 20:56330301-56330323 AAGCCTATGGCCAGGCATGGTGG + Intergenic
1176025132 20:62981898-62981920 CAGGCTCTACGCTGGCAAGGAGG - Intergenic
1176599788 21:8781395-8781417 CAGACTAAGGCCAGGCATGGTGG - Intergenic
1178328669 21:31666259-31666281 AAGTCTATGGCCAGGCATGGTGG - Intronic
1178333826 21:31726371-31726393 AAGGATCTAGCCAGGCATGGTGG + Intronic
1179288957 21:40001698-40001720 CTGGCTATGGCCAAGCATGGCGG + Intergenic
1180646540 22:17343716-17343738 AAGGCCATGGCCAGGCATGGTGG - Intergenic
1181415853 22:22758373-22758395 CAGGGTGTGCCCAGGCCTGGAGG + Intronic
1181420145 22:22792160-22792182 CAGGGTGTGCCCAGGCCTGGAGG + Intronic
1181748663 22:24973681-24973703 TATGCAATAACCAGGCATGGTGG - Intronic
1182943537 22:34300805-34300827 GAGGCTTTGGCCAGGCATGGTGG - Intergenic
1183463794 22:37968796-37968818 CAGGCTGCACCTAGGCCTGGAGG - Exonic
1183718463 22:39548183-39548205 CAGGGAATTCACAGGCATGGGGG + Intergenic
1184050829 22:42003002-42003024 GAAACTATAGCCAGGCATGGTGG + Intronic
1184429538 22:44433705-44433727 GAGGCTAGAGCCAGGCAAGGTGG - Intergenic
1185045839 22:48528370-48528392 TTGGCTATACACAGGCATCGGGG - Intronic
949483929 3:4519510-4519532 CAAGCCATGGCCAGGCATGGTGG - Intronic
950070656 3:10149398-10149420 CAGGCCCTGGCCAGGCATGGTGG - Intronic
950214814 3:11151955-11151977 CAGTCTCTACTCAGGCATTGAGG + Intronic
950547489 3:13647138-13647160 AAGGCAAGAGCCAGGCATGGCGG - Intergenic
951217381 3:20038428-20038450 CACCCTTTACCCATGCATGGAGG + Intergenic
952453722 3:33453716-33453738 CAGGGGAGACTCAGGCATGGTGG - Intergenic
953314302 3:41911863-41911885 CAGGCTAAGGCCAGGCGTGGTGG + Intronic
953501520 3:43439726-43439748 CAGAATTTAGCCAGGCATGGTGG + Intronic
953702522 3:45207829-45207851 CAGGCTATACCCAGGGAAGTGGG - Intergenic
953790051 3:45940524-45940546 CAGGCTGTCCGCAGGCATGGTGG - Intronic
954836431 3:53473242-53473264 CTGGTGATACCCAGGCATGCAGG - Intergenic
955290142 3:57684470-57684492 GAGTCTAAAGCCAGGCATGGTGG + Intronic
955345752 3:58160704-58160726 TAGGCTCTGACCAGGCATGGTGG + Intronic
959056729 3:101574462-101574484 CCGGCTCTCCCCAGGCAAGGAGG - Intronic
959571843 3:107893210-107893232 CTGGCTAAGCCAAGGCATGGAGG + Intergenic
960947313 3:122975428-122975450 CAGGCTGTGCCGAGGCAGGGGGG - Intronic
961907884 3:130281508-130281530 AAGGCTGTGGCCAGGCATGGTGG + Intergenic
962140924 3:132790033-132790055 CAGATTCTAGCCAGGCATGGTGG - Intergenic
962220715 3:133562567-133562589 CAGGAATTAGCCAGGCATGGTGG - Intergenic
962606402 3:137035996-137036018 TGGGCTATTCTCAGGCATGGGGG + Intergenic
963281219 3:143386268-143386290 CTGTTTATACCCAGGCATGCAGG + Intronic
963752889 3:149201406-149201428 CAGGCTAGGGCCAGGCGTGGTGG - Intronic
965258566 3:166448878-166448900 CAGGTAATACCCAGACATGACGG + Intergenic
966389908 3:179441444-179441466 CATGGTAAAGCCAGGCATGGTGG + Intronic
967431678 3:189392779-189392801 CAGGCTTTGGCCAGGCGTGGTGG - Intergenic
967953615 3:194860126-194860148 CAAGCTTCAGCCAGGCATGGTGG + Intergenic
968116616 3:196095292-196095314 AAGGCTAGAGCCAGGCATGCTGG - Intergenic
968863782 4:3194595-3194617 CAGACTATACCCAGTCAGGGTGG + Intronic
969172473 4:5375276-5375298 CAGGCTGTGTACAGGCATGGTGG - Intronic
969971590 4:11053654-11053676 CTGGGCATAGCCAGGCATGGTGG - Intergenic
970287578 4:14535363-14535385 CATGCTTTATCCAGTCATGGTGG + Intergenic
971335938 4:25724264-25724286 CAGGAATTAGCCAGGCATGGTGG + Intergenic
972004552 4:34083320-34083342 CAAGTAATAGCCAGGCATGGTGG - Intergenic
973191933 4:47395240-47395262 CAGGCTATACAAAGGCTTGGAGG + Intronic
974649685 4:64738419-64738441 CATGCCATACCCATGCCTGGGGG - Intergenic
975209418 4:71681526-71681548 CAGTCCATAGCCAGGCATGGTGG + Intergenic
975610106 4:76195079-76195101 CAAGCAGTAGCCAGGCATGGTGG + Intronic
978397096 4:108292870-108292892 CAATCTACAGCCAGGCATGGTGG + Intergenic
979368684 4:119856846-119856868 CAGGCTCAGGCCAGGCATGGTGG + Intergenic
979710410 4:123772660-123772682 CTGGCTGTACACACGCATGGGGG + Intergenic
980915237 4:139027325-139027347 GAGCCTTTAGCCAGGCATGGTGG - Intronic
981818653 4:148860764-148860786 CACACAATAGCCAGGCATGGTGG - Intergenic
982503148 4:156184647-156184669 CAGAATCTACCCAGGCTTGGAGG + Intergenic
983257780 4:165421301-165421323 CAGGCTATGGCCAGGCACGTAGG - Intronic
983424692 4:167568494-167568516 CAGGATAAGGCCAGGCATGGTGG + Intergenic
983701071 4:170594660-170594682 GAGGTTACAGCCAGGCATGGTGG - Intergenic
984004425 4:174292077-174292099 AAGGAAATAGCCAGGCATGGTGG - Intronic
986419228 5:7560839-7560861 CAGAATTTAGCCAGGCATGGTGG - Intronic
986474191 5:8109155-8109177 CAGGCTATACCAAGACCTGGTGG + Intergenic
987287343 5:16469798-16469820 CAGGCTGTACAGAAGCATGGTGG - Intergenic
988504706 5:31811700-31811722 CAAGCTCTAGCCAGGCAGGGTGG + Intronic
989165980 5:38433931-38433953 CTGGCTGGACCCAGCCATGGGGG + Intronic
989362384 5:40617517-40617539 TATGCTATACCCACACATGGGGG + Intergenic
989980287 5:50635416-50635438 CTGGATACAGCCAGGCATGGTGG + Intergenic
990943363 5:61226320-61226342 GAGGCTTTACCCAGACATGGTGG - Intergenic
991722168 5:69503945-69503967 CAGGAATTAGCCAGGCATGGTGG + Intronic
992382417 5:76251253-76251275 CAGGTTGTGTCCAGGCATGGTGG + Intronic
995001614 5:107138017-107138039 AAGGCTGTACACAGACATGGTGG + Intergenic
995390115 5:111631530-111631552 CAGAATATTGCCAGGCATGGTGG - Intergenic
996629694 5:125612652-125612674 CAGGATTTACCCAGTCATGATGG + Intergenic
997015188 5:129924491-129924513 CAAGCATTAGCCAGGCATGGTGG + Intronic
997238687 5:132291562-132291584 CAGGTTTAAGCCAGGCATGGTGG + Intronic
997260940 5:132465139-132465161 CAGGCACTACCCAGGCACTGTGG - Intronic
997271279 5:132540433-132540455 CAGCACACACCCAGGCATGGTGG - Intergenic
997412537 5:133701113-133701135 CAGGTGAGAGCCAGGCATGGTGG + Intergenic
997461147 5:134053370-134053392 CAGAGTATCCCCAGGCATGGTGG - Intergenic
998835963 5:146203445-146203467 CAGGCGGTACCCAGTCAGGGAGG - Intergenic
998879264 5:146630100-146630122 GAGGCCACAGCCAGGCATGGTGG - Intronic
999240409 5:150124380-150124402 CAGGCCAGGCCCAGTCATGGAGG + Intronic
999714214 5:154346085-154346107 AAGGAAATAGCCAGGCATGGTGG - Intronic
1000359267 5:160432581-160432603 CAGGTTATACCTGGGCTTGGTGG - Intergenic
1001097531 5:168787317-168787339 CCTGCTATCCCAAGGCATGGCGG - Intronic
1002668550 5:180846146-180846168 CAGGCTGATCCCAGACATGGTGG - Intergenic
1003345784 6:5265269-5265291 CAGTGTATATCCAAGCATGGAGG + Intronic
1003380652 6:5621741-5621763 CAGGATAGACCCACTCATGGTGG + Intronic
1004344195 6:14833117-14833139 CAATCTCTAGCCAGGCATGGTGG - Intergenic
1004600877 6:17148856-17148878 CAGGGTATACTCAGGCGTGCTGG - Intergenic
1004828461 6:19450211-19450233 CAAAAAATACCCAGGCATGGTGG + Intergenic
1005311962 6:24567412-24567434 GAGGCAATGGCCAGGCATGGTGG + Intronic
1005472436 6:26174488-26174510 GAAGCTATACACAGGCATGATGG - Intergenic
1005621023 6:27620450-27620472 CAGAAAATACCCAGGCATAGTGG - Intergenic
1005987864 6:30885258-30885280 CAGCCAAGAGCCAGGCATGGGGG - Intronic
1006138619 6:31913229-31913251 CAGACTACAGTCAGGCATGGTGG - Intronic
1006309031 6:33244206-33244228 CAGGCACTAGCCAGGCGTGGTGG - Intergenic
1006318944 6:33308033-33308055 CAGGCTTTTTCCGGGCATGGTGG + Intronic
1006666672 6:35699757-35699779 GAGGAAATAGCCAGGCATGGTGG + Intronic
1006947661 6:37795932-37795954 TATGCCATAGCCAGGCATGGTGG + Intergenic
1007621648 6:43219034-43219056 AAAACTTTACCCAGGCATGGTGG + Intronic
1010122713 6:72396858-72396880 CAAAATATAGCCAGGCATGGTGG + Intronic
1010484934 6:76399301-76399323 CAGTCCTTAGCCAGGCATGGTGG - Intergenic
1012384274 6:98659927-98659949 CAAGCTATAAACAGACATGGAGG - Intergenic
1013973392 6:116047355-116047377 CAGACTCTACCCAGAGATGGAGG + Intronic
1017051412 6:150397415-150397437 CAAAATATAGCCAGGCATGGTGG + Intronic
1017485187 6:154895999-154896021 CAGGGTTTGGCCAGGCATGGTGG - Intronic
1018042946 6:159941143-159941165 CAGGCTCTACCCAGGAAAGGTGG + Intergenic
1018387406 6:163317410-163317432 CAGGCTTTGGCCAGGCACGGTGG + Intergenic
1018388102 6:163322725-163322747 CAATCATTACCCAGGCATGGTGG + Intergenic
1020234070 7:6341843-6341865 CAAACATTACCCAGGCATGGTGG + Intronic
1021729333 7:23581267-23581289 CAGGGTCTGACCAGGCATGGTGG - Intergenic
1021764958 7:23939625-23939647 GTGGCTATAGCCAGGCATGGTGG + Intergenic
1022242120 7:28522684-28522706 CAAGGTATAGCCAGGCACGGTGG - Intronic
1023034781 7:36120775-36120797 CTGGTGATACCCAGGCAAGGAGG + Intergenic
1023073093 7:36457158-36457180 CTGTCTCTAGCCAGGCATGGTGG - Intergenic
1023497725 7:40815871-40815893 CAGTCTATGCCCAGGAAGGGTGG + Intronic
1023868631 7:44251154-44251176 CTGGCCAGACCCAGGCAGGGAGG - Intronic
1025135182 7:56405618-56405640 CAGGCTATATGCAGGGATGCAGG + Intergenic
1026231356 7:68486783-68486805 AAGCCTAGAGCCAGGCATGGTGG + Intergenic
1026652075 7:72224494-72224516 CAGGATATGGCCAGACATGGTGG + Intronic
1027268378 7:76506124-76506146 CAGGCCACAGCCAGGCATGGAGG + Intergenic
1027612641 7:80380710-80380732 CATGCTTTTGCCAGGCATGGTGG + Intronic
1027653751 7:80903507-80903529 CAAGCACTAGCCAGGCATGGTGG + Intronic
1027731795 7:81883779-81883801 CAGGAATTAGCCAGGCATGGTGG - Intergenic
1029857121 7:103528848-103528870 AAGAATATAGCCAGGCATGGTGG + Intronic
1031023989 7:116660717-116660739 CAGGCTTTACCCAGGTAATGTGG - Intergenic
1031273341 7:119684070-119684092 CAGTGTATGCCAAGGCATGGAGG + Intergenic
1032094382 7:128930319-128930341 CAAACTTTAGCCAGGCATGGTGG + Intergenic
1032596643 7:133247561-133247583 CTGGTTTTAGCCAGGCATGGTGG + Intergenic
1034748035 7:153541359-153541381 AAGGTTAGGCCCAGGCATGGTGG - Intergenic
1035182415 7:157098964-157098986 CAGAATTTAGCCAGGCATGGTGG - Intergenic
1036410438 8:8494858-8494880 CAGGGTTTGGCCAGGCATGGCGG - Intergenic
1036815018 8:11895977-11895999 TAGGCTATACCTATGAATGGTGG - Intergenic
1037267399 8:17079780-17079802 TAGTCTTTAGCCAGGCATGGTGG - Intronic
1037697172 8:21233698-21233720 CAGGCTGTACGCAAGCATAGAGG - Intergenic
1037885541 8:22594326-22594348 CAGGTCATACCCAGGGCTGGCGG - Intronic
1039801480 8:40960440-40960462 CAGTCCAAAGCCAGGCATGGTGG + Intergenic
1040012800 8:42676359-42676381 CAGGCAAGACAAAGGCATGGAGG - Intergenic
1040104922 8:43536128-43536150 CAGGGTGTTCCCAGGCAAGGTGG + Intergenic
1040358759 8:46644946-46644968 CAGGCTGTACCCAGGTAAGGTGG + Intergenic
1040562666 8:48538256-48538278 CAGGGTCTGCCCAGGCATGTGGG + Intergenic
1042215417 8:66426128-66426150 CAGGCTCTGGCCAGGCGTGGTGG - Intergenic
1043465138 8:80497946-80497968 CAGGACATGGCCAGGCATGGTGG - Intronic
1043681997 8:83040046-83040068 ATGCCTATAGCCAGGCATGGTGG + Intergenic
1044701634 8:94970436-94970458 CAGAAAATAGCCAGGCATGGTGG + Intronic
1046839724 8:118842844-118842866 CAGGCTATTTCCACTCATGGTGG - Intergenic
1048833776 8:138499319-138499341 AAAACTTTACCCAGGCATGGTGG - Intergenic
1049195680 8:141314456-141314478 CAGGTTCTGCCCAGGCCTGGAGG - Intergenic
1050545016 9:6702356-6702378 CATGCTATACCAAGGCGTGATGG + Intergenic
1050569783 9:6925578-6925600 GAGGGTCTGCCCAGGCATGGTGG - Intronic
1050782199 9:9351312-9351334 CAGGCCATACCCAGGAATTCAGG - Intronic
1051046509 9:12881927-12881949 CAGGCCATAGCCAGGCGTGGTGG + Intergenic
1051086801 9:13359450-13359472 AAGGCTATGGCCGGGCATGGTGG - Intergenic
1052538125 9:29773943-29773965 AAGGTTATATCCAAGCATGGTGG + Intergenic
1052766283 9:32644604-32644626 AGGGCTATAGCCAGGCATGGTGG - Intergenic
1052903178 9:33812762-33812784 TAGGATATGGCCAGGCATGGTGG + Intergenic
1053510021 9:38679795-38679817 CAGGCAACACTCAGGCCTGGAGG - Intergenic
1054909646 9:70442541-70442563 CAGGTTCAAACCAGGCATGGTGG + Intergenic
1055560612 9:77517890-77517912 GAGGATATGGCCAGGCATGGTGG - Intronic
1056417496 9:86390796-86390818 CTGGCTATACCCAGGCAAACAGG + Intergenic
1056472594 9:86920364-86920386 CAGGTAAAAACCAGGCATGGTGG - Intergenic
1057143950 9:92746033-92746055 CTGGCTAAAGCCAGTCATGGTGG + Intronic
1057777918 9:98025881-98025903 CACGAAATAGCCAGGCATGGTGG + Intergenic
1060498702 9:124136727-124136749 CAGCCTGTAGCCAGGCATGGTGG + Intergenic
1061534923 9:131241651-131241673 CAGGCTAAGGGCAGGCATGGTGG + Intergenic
1061669655 9:132181600-132181622 CTGGCTATGGCCAGGCACGGTGG - Intronic
1061754742 9:132804549-132804571 CAGGCTCTTCCCAGGGAGGGGGG + Intronic
1061871405 9:133522612-133522634 CAGCCTAGGCCCAGGCAGGGAGG + Intronic
1062098923 9:134717892-134717914 CTGGCTCAACCCAGGGATGGGGG + Intronic
1185458893 X:324663-324685 CAGAATTTAGCCAGGCATGGTGG - Intergenic
1186222471 X:7364577-7364599 CAGGCTACAAGAAGGCATGGAGG + Intergenic
1188853276 X:35158728-35158750 AAGACTGTACCCAGGCATGGTGG + Intergenic
1189550626 X:42088822-42088844 CAGACTATCCCCAGGCAAGAGGG - Intergenic
1190307571 X:49093992-49094014 CAGAAAATAGCCAGGCATGGTGG - Intronic
1190551151 X:51582310-51582332 CAGCTTTTAGCCAGGCATGGTGG + Intergenic
1190640320 X:52478026-52478048 AAGCATATACCCAGGCATGGTGG + Intergenic
1190647352 X:52534839-52534861 AAGCATATACCCAGGCATGGTGG - Intergenic
1192758434 X:74070052-74070074 CAGAATGTAGCCAGGCATGGTGG + Intergenic
1194576552 X:95620496-95620518 CTGGTGATTCCCAGGCATGGTGG - Intergenic
1194732698 X:97474475-97474497 CAGGGTAAGGCCAGGCATGGTGG + Intronic
1196931006 X:120682072-120682094 AAGGCAAGAGCCAGGCATGGTGG - Intergenic
1197487731 X:127074734-127074756 CAGGCCATTCCCAGCTATGGTGG - Intergenic
1197903264 X:131395869-131395891 CAAGCTATAACCATGCCTGGTGG + Intronic
1198438606 X:136640248-136640270 CAGGCTGAGGCCAGGCATGGTGG + Intergenic
1198477827 X:137012489-137012511 CAAGAAATAGCCAGGCATGGTGG - Intergenic
1198761881 X:140040852-140040874 CAGCCAGTACCCAGGCATGGAGG - Intergenic
1199126006 X:144121564-144121586 GAGGCTATAGCAAGACATGGTGG - Intergenic
1201592106 Y:15626964-15626986 CAGGCTATGAGAAGGCATGGAGG + Intergenic