ID: 1174592712

View in Genome Browser
Species Human (GRCh38)
Location 20:51658868-51658890
Sequence ATGAAAATTAAGACCACTGG CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 265
Summary {0: 1, 1: 0, 2: 1, 3: 22, 4: 241}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1174592704_1174592712 26 Left 1174592704 20:51658819-51658841 CCCCACCTAGGCTTCCTTTGAAG 0: 1
1: 1
2: 1
3: 10
4: 136
Right 1174592712 20:51658868-51658890 ATGAAAATTAAGACCACTGGCGG 0: 1
1: 0
2: 1
3: 22
4: 241
1174592703_1174592712 27 Left 1174592703 20:51658818-51658840 CCCCCACCTAGGCTTCCTTTGAA 0: 1
1: 0
2: 1
3: 13
4: 168
Right 1174592712 20:51658868-51658890 ATGAAAATTAAGACCACTGGCGG 0: 1
1: 0
2: 1
3: 22
4: 241
1174592710_1174592712 12 Left 1174592710 20:51658833-51658855 CCTTTGAAGAAAGGGTTCTACTG 0: 1
1: 0
2: 1
3: 13
4: 168
Right 1174592712 20:51658868-51658890 ATGAAAATTAAGACCACTGGCGG 0: 1
1: 0
2: 1
3: 22
4: 241
1174592705_1174592712 25 Left 1174592705 20:51658820-51658842 CCCACCTAGGCTTCCTTTGAAGA 0: 1
1: 0
2: 1
3: 8
4: 162
Right 1174592712 20:51658868-51658890 ATGAAAATTAAGACCACTGGCGG 0: 1
1: 0
2: 1
3: 22
4: 241
1174592707_1174592712 21 Left 1174592707 20:51658824-51658846 CCTAGGCTTCCTTTGAAGAAAGG 0: 1
1: 0
2: 0
3: 20
4: 229
Right 1174592712 20:51658868-51658890 ATGAAAATTAAGACCACTGGCGG 0: 1
1: 0
2: 1
3: 22
4: 241
1174592706_1174592712 24 Left 1174592706 20:51658821-51658843 CCACCTAGGCTTCCTTTGAAGAA 0: 1
1: 0
2: 0
3: 19
4: 182
Right 1174592712 20:51658868-51658890 ATGAAAATTAAGACCACTGGCGG 0: 1
1: 0
2: 1
3: 22
4: 241

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1174592712 Original CRISPR ATGAAAATTAAGACCACTGG CGG Intronic
902043252 1:13507529-13507551 ATGAGAATAAAAAACACTGGGGG + Intronic
903550853 1:24156730-24156752 CTGGAACTTGAGACCACTGGAGG - Exonic
903890212 1:26564769-26564791 ATGACAATTAAAAGCACAGGGGG - Intronic
903983519 1:27207215-27207237 TTAAATCTTAAGACCACTGGTGG - Intergenic
904577544 1:31514708-31514730 AGAAGAATGAAGACCACTGGGGG - Intergenic
904765418 1:32842435-32842457 CTGAAAAATAAGAACACTAGTGG - Intronic
906394492 1:45449891-45449913 ATGAAATTTCAACCCACTGGGGG - Intronic
906827554 1:48997829-48997851 ATGACAATATACACCACTGGTGG - Intronic
911178974 1:94844217-94844239 AGAAAAATTAGGGCCACTGGAGG + Intronic
911792907 1:102040979-102041001 CAGCAAATTAAGATCACTGGAGG - Intergenic
915859087 1:159422812-159422834 GTGAAAATGAGGACCACTGGGGG + Intergenic
916776738 1:167973434-167973456 ATTAATATAAAAACCACTGGGGG - Intronic
919168385 1:193924314-193924336 ATGAAAATTATGACTTCTGTAGG + Intergenic
919736049 1:200951778-200951800 AAGAAAATGAAGACTTCTGGAGG - Intergenic
920212950 1:204341599-204341621 ATGAAAATGTAGACCACAGCAGG - Intronic
920891922 1:209995369-209995391 ATAAAAATTAAGAACAATGAAGG + Intronic
921079671 1:211728678-211728700 ATGAAAATTAAAACCACCAAGGG - Intergenic
921380797 1:214522716-214522738 GTGAAAATGAAGACCACCAGAGG + Intronic
1064725052 10:18270625-18270647 ATGAAATTCAATGCCACTGGGGG - Intronic
1064728363 10:18303937-18303959 ATAAAAAATAAAAACACTGGCGG - Intronic
1064915131 10:20448279-20448301 ATGAAAAATAATACCACTTTTGG + Intergenic
1064952395 10:20867965-20867987 ATGAAAATGAAGACCAGTGAAGG - Intronic
1065410379 10:25420451-25420473 ATCAAAATTAAAGACACTGGGGG - Intronic
1066795124 10:39111756-39111778 AAATGAATTAAGACCACTGGAGG + Intergenic
1067137917 10:43628002-43628024 ATTAAAATTGAGACCATTGTTGG + Intergenic
1068023747 10:51617159-51617181 ATGGGAATATAGACCACTGGGGG + Intronic
1068802190 10:61154024-61154046 ATGAAAACTAAATCCACTGTTGG + Intergenic
1069027588 10:63560495-63560517 ATGAAAAATAAAACCACTTATGG - Intronic
1074069660 10:110053641-110053663 GTGAAAATTAAGACTACTGATGG - Intronic
1074185749 10:111098309-111098331 ATGGAATTTATGACCTCTGGTGG - Intergenic
1075501817 10:122981441-122981463 GTGGAAACTGAGACCACTGGGGG + Intronic
1075608130 10:123831051-123831073 TTGAGAATTCAGACCACAGGAGG + Intronic
1077436697 11:2543035-2543057 ATGAAAGTTAAAACCACAGCAGG - Intronic
1078116380 11:8456052-8456074 ATGAAAAAGAAGAACAATGGAGG - Intronic
1078605709 11:12773479-12773501 ATGCAAATTAAAACCACATGAGG - Intronic
1079265879 11:18932426-18932448 GTGGAAATTATAACCACTGGTGG + Intergenic
1079845078 11:25455625-25455647 TTGAAAAGTCAGCCCACTGGAGG - Intergenic
1085081411 11:73637525-73637547 ATGAAAAATAAGAACAGAGGAGG - Intergenic
1085625609 11:78070137-78070159 ATGAACATTCAGACCACAGCAGG - Intronic
1086728269 11:90217620-90217642 ATGAAAATTAAGACCAGGCATGG + Intronic
1086856168 11:91868690-91868712 CTGAAAATTAATACATCTGGAGG + Intergenic
1091384945 12:87719-87741 ATGACACTGAAGACCAGTGGGGG + Intronic
1092021534 12:5206845-5206867 AAGAAAATAAAGACCACAGAGGG - Intergenic
1093672612 12:21895749-21895771 ATGAATATTAATAACACTGCTGG - Intronic
1094798745 12:34005108-34005130 ATGAAAATTAAGAACAATGAAGG + Intergenic
1095111492 12:38299175-38299197 ACGAAAATTAAGAACAATGAAGG + Intergenic
1095693097 12:45113128-45113150 ATGAAAATGAAGAGAACTGAAGG + Intergenic
1096449489 12:51725818-51725840 ATGAAAATTAATACCTCTTGGGG + Intronic
1097482260 12:60143455-60143477 ATAAAAATTAAAACCAATGGAGG - Intergenic
1097772459 12:63604057-63604079 ATGAAAATTAAGATAATTTGTGG - Intronic
1098092378 12:66917819-66917841 TTGAAAATTATGAACACTAGAGG - Intergenic
1098624100 12:72640779-72640801 CTGAAAATTAAAACCTCTGGTGG - Intronic
1099924907 12:89005598-89005620 ATGAAATTCATGACCACTAGAGG + Intergenic
1100744233 12:97627913-97627935 AAGAGTATTAAGATCACTGGGGG + Intergenic
1104173576 12:126306282-126306304 ATGAAAATTAAGAGGGCTGTTGG - Intergenic
1104673412 12:130695941-130695963 ACAAAAATGAAGACCCCTGGAGG + Intronic
1105259073 13:18765417-18765439 AGGAAAATTTGGACCACTGTAGG - Intergenic
1105264103 13:18801325-18801347 AGGAAAATTTGGACCACTGTAGG - Intergenic
1106023714 13:25938502-25938524 ATGAAAGTTAACACCACAGACGG - Intronic
1106279867 13:28257170-28257192 ATGAATATTAAGACCAAAAGAGG + Intronic
1106490817 13:30220070-30220092 ATAAAAATTGATACCAGTGGAGG - Intronic
1107347913 13:39482704-39482726 ATGAGAAGGAATACCACTGGAGG + Intronic
1107892392 13:44925678-44925700 ATGAGAATTAAGATCACTTCTGG + Intergenic
1108329422 13:49370402-49370424 GTGAAAAATACGACCACTGATGG + Intronic
1108726375 13:53186853-53186875 ATGAAAATTAAAACCATGGTGGG + Intergenic
1109105849 13:58249873-58249895 ATTCAAATTATCACCACTGGTGG + Intergenic
1109494482 13:63149766-63149788 ATGACAATTAATGCCACTAGAGG - Intergenic
1112318818 13:98388886-98388908 ATGAAAATGAGTTCCACTGGGGG - Intronic
1112410410 13:99158143-99158165 ATTAAAATTAAAACCACAGCAGG - Intergenic
1112422279 13:99263432-99263454 ATGAAAATTAAAACCACAGCAGG + Intronic
1113865456 13:113519456-113519478 TTGAAAATTGAGACCTTTGGAGG + Intronic
1114967630 14:27983015-27983037 ATGTATTTTAAGACCACTAGTGG - Intergenic
1115182160 14:30641822-30641844 ATAAAATTTAATACCACTTGTGG - Intronic
1115660507 14:35489785-35489807 TTGAAAATTAAGAACAGTGTTGG - Intergenic
1116583450 14:46672472-46672494 AAGAAAAGAAAGCCCACTGGGGG - Intergenic
1118788038 14:69063014-69063036 ATAAAAACCAAAACCACTGGGGG + Intronic
1119501650 14:75133414-75133436 ATGCAAATTAAAACCACATGTGG + Exonic
1120470269 14:84914634-84914656 GTGAAAATTAAGATCACTAAGGG - Intergenic
1122331725 14:100922061-100922083 ATGCAAATTAAAACCACAGTGGG - Intergenic
1122335227 14:100971130-100971152 GTGAAAATTGAGACCAATGATGG + Intergenic
1123455911 15:20425525-20425547 ATAAAAATTAAGAACAATGAAGG - Intergenic
1123635659 15:22305312-22305334 ATAAAAATTAAGAACAATGAAGG + Intergenic
1123810877 15:23925066-23925088 ATGAAAACTCAGAAAACTGGTGG - Intergenic
1124044280 15:26134210-26134232 ATGCAAATTAAAACCACAGTAGG + Intergenic
1125219019 15:37311623-37311645 GGGAAAATTAATACCACTGGAGG + Intergenic
1125493420 15:40166634-40166656 ATGAAAATTATGTCTACTGCTGG - Intronic
1127378495 15:58407143-58407165 ATTGAAATAAAGAGCACTGGAGG - Intronic
1128088551 15:64903380-64903402 ATGAAAACAAAGAGCAGTGGAGG - Intronic
1128406794 15:67349846-67349868 ATGCAAATTAAAACCACAGTGGG + Intronic
1130425028 15:83788642-83788664 AGGAAATTTCAGAACACTGGGGG - Intronic
1135409562 16:22223148-22223170 ATGAAACTTACAACCACTAGGGG - Intronic
1140590044 16:76340882-76340904 GGGAAAATTAGCACCACTGGAGG - Intronic
1140611625 16:76606760-76606782 ATGAAAATTAAGTGCAGTGCAGG + Intronic
1144112528 17:12049952-12049974 ATGGTAATGAAGACCACTGAAGG - Intronic
1144416114 17:15048942-15048964 ATGAAATTTAAGAACATTTGGGG - Intergenic
1145243781 17:21254360-21254382 ATCAAAATACAGAACACTGGTGG + Intergenic
1146050398 17:29547084-29547106 ATGGAAAGTAAGAACACTGATGG + Exonic
1146969797 17:37063376-37063398 ATAAAAATTAAAAACACAGGAGG - Intergenic
1149271434 17:54982759-54982781 ATGACAATGAATACCACTGTTGG + Intronic
1152149672 17:78591098-78591120 TTGAGAATTAAGGGCACTGGAGG + Intergenic
1203159081 17_GL000205v2_random:32604-32626 AGAAACATTAAGACCACAGGAGG + Intergenic
1153889967 18:9503742-9503764 ATGAAATTTCAGAGCACTGGGGG - Intronic
1154984608 18:21537201-21537223 ACCAAAATTAAGACCTCTGTAGG + Intronic
1155515055 18:26616090-26616112 ATGACAATTAAAAGCACTAGTGG - Intronic
1155897118 18:31343443-31343465 ATCAAAAATGGGACCACTGGTGG - Exonic
1156093807 18:33504881-33504903 ATGAAAATTAAAACCACAGTGGG - Intergenic
1158013100 18:52751447-52751469 ATGAAAATTAAGACCCTTCAGGG + Intronic
1159820331 18:73133131-73133153 ATGCAAATTAAAACCACATGAGG + Intergenic
1160262634 18:77309454-77309476 ATGAAAATTAAAACCACAGTGGG + Intergenic
1161406031 19:4091641-4091663 ATAAAAATTAAGGCCAGTTGCGG - Intronic
1165126402 19:33600932-33600954 ATGAAAATAAAGACAACCAGGGG - Intergenic
1168502457 19:56904862-56904884 ATGCAAATTAAAACCACAGTGGG - Intergenic
925701586 2:6644420-6644442 ATGCAAATTAAAACCACAGTGGG + Intergenic
925792177 2:7501611-7501633 ATGAAAATTAAAACCACAGTGGG + Intergenic
926479955 2:13379665-13379687 ATAAAAATTAAGAACAATGAAGG + Intergenic
930985370 2:57580050-57580072 ATGGAAATTACTACCACTTGCGG - Intergenic
931772298 2:65508375-65508397 ATCAAAATTAAGAACACTTATGG - Intergenic
932482509 2:72054592-72054614 ATGCAAATTAAGACCACAATGGG - Intergenic
933411786 2:81935046-81935068 ATGAAAATTAAGAATTTTGGGGG + Intergenic
936399393 2:112154295-112154317 ATGAAAATTTATACCATTTGAGG + Intronic
936503885 2:113089100-113089122 ATGGACATTAAGACCCCTTGGGG + Intergenic
937835725 2:126468695-126468717 ATAAAAATTAACATCATTGGCGG + Intergenic
938410992 2:131064382-131064404 ATGAAATTTCTGAACACTGGAGG + Intronic
938917148 2:135953581-135953603 ATGAAACCTAACACCACTAGAGG - Intronic
939312477 2:140500856-140500878 ATGAAAATTAGGACCATTACAGG - Intronic
940170450 2:150824425-150824447 ATGGGTATTAAGATCACTGGGGG + Intergenic
942132248 2:172892010-172892032 ATGACCATGAAGACCAATGGTGG + Intronic
942354419 2:175093897-175093919 ATGAAAATTAAGGCTCCTGTGGG - Intronic
943624534 2:190183629-190183651 ATTAAAAATAAAAACACTGGGGG + Intronic
943685840 2:190817208-190817230 ATGAAAATTAAAACCACAGTGGG + Intergenic
944821694 2:203439414-203439436 ATGAAAATAAAGTCCTATGGTGG + Exonic
946077159 2:217083902-217083924 ATAGACATTAAGAGCACTGGTGG + Intergenic
946947848 2:224840537-224840559 ATGCAAATTAAAACCACAGTGGG + Intronic
947419068 2:229925066-229925088 AGAAAAATTAAGAACACTGAAGG - Intronic
948267822 2:236649047-236649069 ATGCAAATTAAAACCACAAGGGG - Intergenic
948766124 2:240220403-240220425 ATGAAAATTTAGACAACTGGTGG - Intergenic
1169650649 20:7863495-7863517 ATGAAAATCAAAACCACTATGGG + Intergenic
1171465251 20:25323448-25323470 ATGGAAATTAGGATTACTGGTGG + Intronic
1174592712 20:51658868-51658890 ATGAAAATTAAGACCACTGGCGG + Intronic
1174956448 20:55103905-55103927 ATGTCAACGAAGACCACTGGGGG - Intergenic
1175389620 20:58618788-58618810 ATGAAAATGAAGACCGTTGCAGG + Intergenic
1175561642 20:59934946-59934968 ATCAAAATTAAGTTCAATGGGGG - Intronic
1177449998 21:21253971-21253993 ATAAAATTTAAGACCTATGGAGG + Intronic
1178522073 21:33294793-33294815 GTGAAGATTAAGAGCACTGGTGG + Intronic
1182385100 22:29931799-29931821 AAGCAGATTAAGACCATTGGAGG + Intronic
1182949420 22:34358286-34358308 AGGATAATTAAGGCCACTTGGGG + Intergenic
950680553 3:14582219-14582241 ATGGAAATTAAAACCACAGTGGG - Intergenic
951557067 3:23931608-23931630 ATTAAACTTAAAACCTCTGGGGG - Intronic
951614146 3:24522661-24522683 ATGAAAATTAAAATCACTTCAGG - Intergenic
952031072 3:29143440-29143462 ATGTAAATGTAGACAACTGGAGG - Intergenic
952173083 3:30830854-30830876 AGGAAGATGAAGATCACTGGAGG - Intronic
955156563 3:56422377-56422399 TGGAAAATTAAAACCACAGGTGG - Intronic
955270897 3:57498105-57498127 ATGCAAATTAAAACCACAGTGGG + Intronic
956976159 3:74582611-74582633 ATGCAAATTAAAACCACAGTAGG + Intergenic
956979893 3:74623768-74623790 ATGAATAGAAATACCACTGGTGG + Intergenic
957352447 3:79043293-79043315 ATAAAACTTCAGACCACTTGAGG - Intronic
957734181 3:84185360-84185382 CTGAGAATTAAGACCACTCCAGG - Intergenic
958586541 3:96094297-96094319 ATGAAAATTAAAAGTACTAGAGG + Intergenic
962191310 3:133313668-133313690 ATGAAAATTAACATCAATGAAGG - Intronic
962725938 3:138226837-138226859 GAGAAAATTGAGACCCCTGGAGG + Intronic
963265545 3:143236748-143236770 AAGAAAATTATAAGCACTGGTGG - Intergenic
964253269 3:154745245-154745267 ATGAAAATCAAAACCACAGTGGG + Intergenic
964985740 3:162735639-162735661 ATAAGAACTAAGAACACTGGTGG + Intergenic
968270238 3:197397841-197397863 ATGAAAATTAAAACAACAGCCGG + Intergenic
972506511 4:39724923-39724945 AACAAAAATAAGAACACTGGAGG - Intronic
972569463 4:40297088-40297110 ATGAAAATGAAGCCCCATGGTGG + Intergenic
974044125 4:56883336-56883358 TTCAAAATTAAGACAGCTGGGGG + Intergenic
974920061 4:68227869-68227891 AGGAACATAAAGACCACTGTAGG - Exonic
976188973 4:82470987-82471009 GAGATAATTAAGAGCACTGGGGG - Intergenic
976253110 4:83073418-83073440 CTGAAAATGAAAACCAGTGGTGG - Intronic
977257208 4:94754504-94754526 AAGTAAATAGAGACCACTGGGGG - Intergenic
977926377 4:102705188-102705210 ATGGGAATGTAGACCACTGGAGG - Intronic
979121817 4:116912479-116912501 TTGAAAATTAAGATAACTGTAGG + Intergenic
979322850 4:119344229-119344251 ATGAAAATAAGGACTACAGGCGG - Intergenic
981301351 4:143189775-143189797 ATCAAAATTAAAAGCAATGGGGG - Intronic
982610777 4:157571946-157571968 ATGAATATTTTGACCACAGGTGG - Intergenic
983240690 4:165228878-165228900 ATGAAAATAAGGACTACAGGCGG - Exonic
983853786 4:172616800-172616822 ATGAAGATTCAGCCCACTGAGGG - Intronic
985272029 4:188202874-188202896 ATGAGAACTAAAACCATTGGAGG + Intergenic
985329176 4:188808399-188808421 AAGAAAATCAACACCACTGGAGG + Intergenic
986662344 5:10070695-10070717 ATGAATTTTCAGGCCACTGGTGG - Intergenic
987328776 5:16836397-16836419 ATGAAGATGCAAACCACTGGAGG - Intronic
988373055 5:30397088-30397110 ATGCAAATTAAAACGACTGTGGG - Intergenic
989196326 5:38720147-38720169 ATGTAAATTCAGATGACTGGAGG - Intergenic
990921839 5:60977128-60977150 ATAAAAATTGAAAACACTGGTGG + Intronic
991314393 5:65283818-65283840 GTAAAAATTAAGACAACTGTGGG + Intronic
991589209 5:68231450-68231472 ATGAAAACCAACACCAATGGTGG - Intronic
993331816 5:86609899-86609921 ATGCAAATTAAAACCACAGTGGG - Intergenic
993441044 5:87957436-87957458 ATGAAAGTCAAGAGCAGTGGGGG - Intergenic
993910938 5:93683411-93683433 TTCAACCTTAAGACCACTGGTGG + Intronic
995018025 5:107334039-107334061 ATGAAAATAAAGCCAAGTGGCGG - Intergenic
995284666 5:110374107-110374129 ATGAAAAATAACAAAACTGGAGG - Intronic
996171791 5:120302540-120302562 ATGATAGTTAAGAGTACTGGGGG - Intergenic
998558598 5:143149761-143149783 ATGAAAATAAAGAACAAAGGTGG + Intronic
999041433 5:148417547-148417569 ATGAACATTAAGACCATTTCTGG + Intronic
999858137 5:155617298-155617320 ATTAAATTTGAGGCCACTGGAGG - Intergenic
1000828928 5:166079823-166079845 ATGAGAAATAATACCACTTGTGG - Intergenic
1001392591 5:171391733-171391755 TTCAACCTTAAGACCACTGGTGG - Exonic
1001763729 5:174228304-174228326 AGGAAAATGAAGTCCAGTGGGGG + Intronic
1004567072 6:16807933-16807955 ATGAAAATTAAGATAATTTGAGG - Intergenic
1005610378 6:27518287-27518309 ATAAAAATCTAGCCCACTGGAGG - Intergenic
1007905899 6:45460448-45460470 TTGAAAATTAAGAGAAATGGAGG + Intronic
1008061214 6:46998962-46998984 ATGCAAATAAAGACAGCTGGGGG - Exonic
1008479473 6:51970152-51970174 ATGAAAATTAAAACCACAGTGGG - Intronic
1008585385 6:52943795-52943817 AAGAAACTTAAGAACATTGGGGG - Intergenic
1008836051 6:55831811-55831833 GTGAACATTTAGAACACTGGAGG + Intronic
1009059508 6:58381163-58381185 ATCAAAATTAAGACCTCAGTAGG + Intergenic
1009231405 6:61066253-61066275 ATCAAAATTAAGACCTCAGTAGG - Intergenic
1009595804 6:65734386-65734408 ATCAAAATTAACAACACTGGAGG - Intergenic
1010311454 6:74390772-74390794 ATGAATATTAAAAGCACTGCTGG - Intergenic
1010467772 6:76189287-76189309 ATGCAAATTAAAACCACAGTGGG + Intergenic
1011779804 6:90775090-90775112 ATGCAAATTAAAACAACAGGAGG - Intergenic
1012151286 6:95758122-95758144 ATGAAACTTAAGAATTCTGGTGG - Intergenic
1013567839 6:111386375-111386397 ACGAAAATTAAAACCACAGTAGG + Intronic
1014526280 6:122505546-122505568 AAATAAATTAAGACCACTGGAGG - Intronic
1016326591 6:142909906-142909928 ATCAAAATATAGGCCACTGGAGG - Intronic
1017161574 6:151370555-151370577 ATCAAAAATAAAACCACTGAGGG - Intronic
1017446957 6:154515916-154515938 ATGAAAATTAATACCAATCAGGG + Intergenic
1018308922 6:162488558-162488580 ATGATAATGAAGAACACAGGTGG + Intronic
1021207664 7:17805132-17805154 TTGAAAAACATGACCACTGGTGG + Intronic
1021724140 7:23533348-23533370 ATGAAGATTGCTACCACTGGGGG + Intergenic
1022932022 7:35127769-35127791 ATGAAAATTAAGATAATTTGTGG - Intergenic
1024640483 7:51324561-51324583 AGGAAAATTATGACAGCTGGTGG - Intergenic
1025968412 7:66297680-66297702 ATGAAAATGAAGTCAGCTGGGGG + Intronic
1027814133 7:82947148-82947170 ATGAAGATTGAGACCTCTGCTGG - Intronic
1029020865 7:97363848-97363870 ATGGAAATATGGACCACTGGGGG - Intergenic
1029827909 7:103220247-103220269 ATGAAAATTAAGATAATTTGTGG - Intergenic
1030105961 7:105987592-105987614 CTGTAAATTGAAACCACTGGGGG + Intronic
1031921707 7:127606985-127607007 GTGAAAAGTGAGAACACTGGAGG + Intergenic
1031961838 7:127996906-127996928 TTGAAATTAAAGACCACTGGTGG - Intronic
1032421834 7:131786756-131786778 ATGCAGATTAAAACCACTTGAGG - Intergenic
1033476275 7:141696303-141696325 ATGAATTTTAAGACAGCTGGGGG - Intronic
1037415130 8:18641375-18641397 ATGATGATTAAGACCCCTCGAGG + Intronic
1039332688 8:36556303-36556325 ATGCACATTAAAACCACTGTGGG + Intergenic
1046209433 8:111048551-111048573 ATGAATATTAAGTACACTGATGG + Intergenic
1047014488 8:120709236-120709258 AGGAAATTTAAGAACACTAGAGG - Intronic
1049873118 8:144996937-144996959 ATGCAAATTAAAACCACATGTGG - Intergenic
1050838560 9:10116149-10116171 CTGAACATTAAGACCATAGGAGG + Intronic
1053594786 9:39548800-39548822 ATGGAAATTAAGACCACATTTGG + Intergenic
1053852570 9:42303833-42303855 ATGGAAATTAAGACCACATTTGG + Intergenic
1054571468 9:66816167-66816189 ATGGAAATTAAGACCACATTTGG - Intergenic
1055119790 9:72646481-72646503 ATGGAAATCAAGACCACTACAGG - Intronic
1056845280 9:90032251-90032273 ATGACAATGAAAACCACTGCAGG + Intergenic
1057237071 9:93369906-93369928 ATGTAAATTAATACAATTGGAGG - Intergenic
1057437193 9:95052066-95052088 ATGAAAATTCAGACCAGGAGTGG - Intronic
1058214268 9:102214181-102214203 ATGACAAATAAGATCACAGGGGG + Intergenic
1058469808 9:105265828-105265850 ATGCAAATTAAAACCACAGTGGG - Intronic
1058682737 9:107454426-107454448 ATAAAAAATAAGAGCTCTGGTGG + Intergenic
1059213529 9:112537567-112537589 ATGAAAATTAAAACCTCAGTAGG + Intronic
1059617102 9:115962956-115962978 ATAAAAATCAAGACAACTGATGG - Intergenic
1062155191 9:135044209-135044231 ATGAAAATTAAGATCAAGGGAGG - Intergenic
1186115301 X:6299201-6299223 AAGAAAATGAAGACCAATGAAGG - Intergenic
1186485512 X:9931654-9931676 ATGAAAATTAAGACCAACAAAGG - Intronic
1186487355 X:9943808-9943830 ATAAAAATTAAGACCAATAAAGG - Intronic
1187475031 X:19603086-19603108 ATGAAAACAAAGACAAATGGAGG + Intronic
1189592714 X:42532113-42532135 ATGAAAATAATAAACACTGGGGG - Intergenic
1189748241 X:44192148-44192170 ATCAAAATTAAGAACTCAGGAGG - Intronic
1191222159 X:58001185-58001207 AGAAAAATTAAGACCTATGGAGG + Intergenic
1192305984 X:69960044-69960066 ATGAAATGGAGGACCACTGGAGG + Intronic
1194495239 X:94608359-94608381 AGGAAAAATAACACAACTGGAGG - Intergenic
1196132970 X:112177390-112177412 ATGCAAATTAAAACCACTATGGG - Intergenic
1197333660 X:125184868-125184890 ATAAAAATTAAAACCAATGAGGG + Intergenic
1200415795 Y:2908416-2908438 ATAAAAATTTAGACCATGGGTGG - Intronic
1201544012 Y:15140726-15140748 ATTACAATTAAGACCACTTTTGG - Intergenic
1201549154 Y:15201114-15201136 ATGAAAATTAAGAGAAATGGTGG - Intergenic