ID: 1174596550

View in Genome Browser
Species Human (GRCh38)
Location 20:51688748-51688770
Sequence AGCCTCCAGCCAGAACATCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 274
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 257}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1174596547_1174596550 2 Left 1174596547 20:51688723-51688745 CCAGCGCGACATACCCTACAAAC 0: 1
1: 0
2: 0
3: 1
4: 21
Right 1174596550 20:51688748-51688770 AGCCTCCAGCCAGAACATCCAGG 0: 1
1: 0
2: 1
3: 15
4: 257
1174596543_1174596550 19 Left 1174596543 20:51688706-51688728 CCCCAGTGCTGGCAGTCCCAGCG 0: 1
1: 0
2: 1
3: 21
4: 525
Right 1174596550 20:51688748-51688770 AGCCTCCAGCCAGAACATCCAGG 0: 1
1: 0
2: 1
3: 15
4: 257
1174596544_1174596550 18 Left 1174596544 20:51688707-51688729 CCCAGTGCTGGCAGTCCCAGCGC 0: 1
1: 0
2: 0
3: 23
4: 147
Right 1174596550 20:51688748-51688770 AGCCTCCAGCCAGAACATCCAGG 0: 1
1: 0
2: 1
3: 15
4: 257
1174596542_1174596550 26 Left 1174596542 20:51688699-51688721 CCTAGGGCCCCAGTGCTGGCAGT 0: 1
1: 0
2: 3
3: 44
4: 354
Right 1174596550 20:51688748-51688770 AGCCTCCAGCCAGAACATCCAGG 0: 1
1: 0
2: 1
3: 15
4: 257
1174596546_1174596550 3 Left 1174596546 20:51688722-51688744 CCCAGCGCGACATACCCTACAAA 0: 1
1: 0
2: 0
3: 1
4: 20
Right 1174596550 20:51688748-51688770 AGCCTCCAGCCAGAACATCCAGG 0: 1
1: 0
2: 1
3: 15
4: 257
1174596545_1174596550 17 Left 1174596545 20:51688708-51688730 CCAGTGCTGGCAGTCCCAGCGCG 0: 1
1: 0
2: 1
3: 5
4: 107
Right 1174596550 20:51688748-51688770 AGCCTCCAGCCAGAACATCCAGG 0: 1
1: 0
2: 1
3: 15
4: 257

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1174596550 Original CRISPR AGCCTCCAGCCAGAACATCC AGG Intronic
901853536 1:12030325-12030347 AGCCTGCAGGCAGATCACCCTGG - Intronic
902434798 1:16391571-16391593 AGCCTCAAGCCACCACGTCCTGG - Intronic
903952938 1:27006552-27006574 AGACTCCTTCCAGATCATCCTGG - Exonic
904318775 1:29682959-29682981 ATCCTCCAGCCAGTTAATCCAGG - Intergenic
904375123 1:30076335-30076357 AGACTTCTGCCTGAACATCCAGG - Intergenic
904539912 1:31225823-31225845 AGCCTCCAGCCAGCTTCTCCTGG - Intronic
904766868 1:32856329-32856351 AGCATTAAGCCAGAACACCCAGG + Exonic
905661906 1:39733926-39733948 AGCCTCAAGCCTCAACCTCCTGG - Intronic
906353727 1:45085030-45085052 AGACTCCTGCCTGGACATCCAGG + Intronic
907032189 1:51183515-51183537 TGCCTCCAGTGAGAACTTCCAGG + Intergenic
907248386 1:53122254-53122276 AGCATCCAGTCACAACCTCCTGG + Intronic
907629189 1:56062753-56062775 AGCCTCCAGTCAGAGAAACCAGG + Intergenic
909741686 1:79037249-79037271 AGACTTCTGCCTGAACATCCAGG - Intergenic
910521118 1:88123498-88123520 AGCCTCCCGCCAGCACGCCCAGG - Intergenic
913971176 1:143419684-143419706 TGTCTCCAGCCACAATATCCCGG + Intergenic
914065554 1:144245297-144245319 TGTCTCCAGCCACAATATCCTGG + Intergenic
914113597 1:144721057-144721079 TGTCTCCAGCCACAATATCCTGG - Intergenic
914887028 1:151593889-151593911 AGCCTTTAGCCAGACCCTCCGGG + Intergenic
915665430 1:157440065-157440087 AGACTTCTGCCTGAACATCCAGG + Intergenic
915885681 1:159718460-159718482 AGACTTCTGCCTGAACATCCAGG - Intergenic
916673940 1:167050510-167050532 GGCCCCAAGCCAGAATATCCAGG + Intergenic
917051711 1:170932048-170932070 AGACTGCTGCCTGAACATCCAGG + Intergenic
918684839 1:187401518-187401540 TGCATCCACCCAGATCATCCAGG + Intergenic
919155155 1:193754867-193754889 ACCATCCAGCAAGAAAATCCAGG + Intergenic
920912452 1:210232092-210232114 AGCCTCCAGGGAAAACCTCCAGG - Intergenic
922193586 1:223340647-223340669 AGGCTCCAGGCAAAAGATCCAGG + Intronic
1062911564 10:1215484-1215506 AGCCTCCTTCCTGCACATCCTGG + Intronic
1063714673 10:8514968-8514990 AGCCTCCACCCAGGCCACCCTGG + Intergenic
1063742292 10:8837308-8837330 AGCTTGCAGACAGAAGATCCTGG - Intergenic
1064818815 10:19299969-19299991 AGCCTCTGGGCAGAACCTCCGGG - Intronic
1069803964 10:71105904-71105926 AAACTCCAGCAAGAACATTCAGG + Intergenic
1070387181 10:75936177-75936199 CGCCCACAGACAGAACATCCTGG - Intronic
1071437475 10:85660634-85660656 AGACTTCAGCCAGAACAGCCTGG - Intronic
1071561978 10:86652064-86652086 AGCTTCCAGCCAGGACAGCTTGG + Intergenic
1072937891 10:99730978-99731000 AGCCTCCAGCTTGGAAATCCTGG - Intronic
1074445902 10:113520619-113520641 AGTTTCCAGCCAGACCATTCAGG - Intergenic
1074853017 10:117453991-117454013 TGCCTACAGCAAAAACATCCTGG - Intergenic
1077310582 11:1887233-1887255 TGTCTCCAGCCACAATATCCTGG - Exonic
1077657113 11:4030025-4030047 AGCCTTTAGAAAGAACATCCAGG + Intronic
1078300938 11:10131632-10131654 AGCCTCCAGCCTGACCAACATGG - Intronic
1079368413 11:19829434-19829456 AGCCTCCACCCTGAATCTCCAGG - Intronic
1080866986 11:36204205-36204227 AGGCTCTGGGCAGAACATCCTGG + Intronic
1082142746 11:48629398-48629420 AGCCTTCACTCACAACATCCTGG + Intergenic
1084008613 11:66335774-66335796 CGTCTCCAGCCACTACATCCTGG - Exonic
1084272546 11:68036920-68036942 AGGCCCCAGCCAGGACACCCGGG - Intergenic
1084698365 11:70769896-70769918 AGGCACCAGCCAGCACACCCTGG + Intronic
1085818859 11:79770804-79770826 AGACTCCTGCCTGGACATCCAGG - Intergenic
1089302483 11:117507030-117507052 AGGCTCCAGACAGGCCATCCAGG - Intronic
1090466642 11:126940704-126940726 AGCCTCCAGCTAGAACACTGAGG + Intronic
1090950825 11:131471783-131471805 AGTCCCCAGACAGAACCTCCAGG - Intronic
1090960068 11:131548322-131548344 ATCCCCCAGGCAGTACATCCAGG + Intronic
1091218546 11:133917962-133917984 AGCCTGCTGCCAGTACACCCAGG - Intronic
1091491792 12:938834-938856 AGACTGCAGCCACAACCTCCTGG + Intronic
1092681892 12:10992524-10992546 ATCCCCCTGCCAGAACTTCCTGG + Intronic
1094125062 12:27014539-27014561 GGCCTCAAGCCAGGACTTCCTGG - Intergenic
1096106912 12:49001416-49001438 ACCCTCCAGCCAGGGCATACTGG - Intergenic
1097208847 12:57348806-57348828 AGCCTGCAGCCTCAACCTCCTGG - Intronic
1097615436 12:61879456-61879478 AGCCTCCACCCAGGCCACCCTGG - Intronic
1097751719 12:63361976-63361998 AGTCCCCACCCAGAACATACGGG - Intergenic
1098703066 12:73653310-73653332 AGACTTCTGCCTGAACATCCAGG - Intergenic
1099760303 12:86912443-86912465 AGACTTCTGCCTGAACATCCAGG - Intergenic
1099907549 12:88790203-88790225 AGACTTCTGCCTGAACATCCTGG + Intergenic
1100891270 12:99128880-99128902 AGCCAAAAGACAGAACATCCTGG + Intronic
1102191190 12:110989759-110989781 ATCCTCCAGCCTCAGCATCCCGG - Intergenic
1102515594 12:113444248-113444270 AGCCTCCTGCCTGAGCTTCCTGG + Intergenic
1102697974 12:114815002-114815024 AGCCTCCAGCCAGCCCAGCTAGG + Intergenic
1103223601 12:119267455-119267477 AGACTTCTGCCTGAACATCCAGG - Intergenic
1103739831 12:123083738-123083760 AGCCTGAAGCCAGCACATCGTGG + Intronic
1104216739 12:126741294-126741316 ATCCTCCAGCAACATCATCCAGG - Intergenic
1104958745 12:132478278-132478300 AGCCTCCAGGAGGAACCTCCTGG + Intergenic
1107535065 13:41321189-41321211 ATCCTCCTGCCTCAACATCCTGG - Intronic
1110780176 13:79456171-79456193 TGCCTTCAGCCAGAACATCACGG + Intergenic
1111318067 13:86586659-86586681 AGACTCCTGCCTGGACATCCAGG - Intergenic
1111421638 13:88019003-88019025 AGCCTTCTGCCTGGACATCCAGG - Intergenic
1111457723 13:88506566-88506588 AGACTTCTGCCTGAACATCCAGG - Intergenic
1111559980 13:89932463-89932485 AGCCTCCCGCCACCACACCCGGG + Intergenic
1112055282 13:95684928-95684950 AACCTTCTGCCTGAACATCCAGG - Intronic
1113531644 13:111031909-111031931 AGCCCCAAGCCAGACCTTCCAGG - Intergenic
1115951498 14:38727179-38727201 AGCCTCCACCCAGGCCACCCTGG - Intergenic
1116872797 14:50083965-50083987 ACCCTCCCACCAGAACATCCAGG + Exonic
1117665060 14:58047875-58047897 AGCATCCACCCAGAAAAGCCAGG + Intronic
1117953843 14:61107810-61107832 AGCCTGCAGCCATTGCATCCAGG - Intergenic
1118610610 14:67536641-67536663 AGTCTACAGCCTGAATATCCTGG - Intronic
1119066229 14:71529855-71529877 AGCCTTCTGCCAGAAGCTCCAGG - Intronic
1120469402 14:84903551-84903573 AGACTTCTGCCTGAACATCCAGG - Intergenic
1122684678 14:103496095-103496117 ACCCTGCAGGCAGAACAGCCAGG + Intronic
1124656886 15:31516116-31516138 AGCCTCCTGGCAGAACACTCTGG + Intronic
1125980415 15:43995767-43995789 AGCCTCCAGACCTAACCTCCAGG - Intronic
1126415707 15:48415708-48415730 AGCCTCCTGTCACAACACCCTGG - Exonic
1129062332 15:72869988-72870010 AGGCTGCAGCCTGATCATCCAGG - Intergenic
1129598056 15:76980292-76980314 AGCCTCCACCCAGGCCACCCTGG + Intergenic
1129601674 15:77002702-77002724 ACCCTGCAGCCAGCAAATCCTGG - Intronic
1129653974 15:77510599-77510621 AGCCTCCTGCCTGACCATGCTGG + Intergenic
1132112861 15:99115066-99115088 AGCCTGCAGCCCCAACCTCCCGG - Intronic
1132605381 16:791578-791600 ACCGTCCACCCAGATCATCCTGG - Intronic
1132747037 16:1441082-1441104 ACGCTCCAGCCTGAACAACCAGG + Intronic
1135690512 16:24533515-24533537 AGGCTCCAGCCACCACACCCAGG - Intergenic
1137608890 16:49805892-49805914 TGCCCCCAGCCAGTCCATCCAGG + Intronic
1137793625 16:51196349-51196371 AGCCACCAGCCAGCATTTCCGGG + Intergenic
1138209284 16:55149547-55149569 TGCCTCCATCCAGAACATGGGGG - Intergenic
1138605482 16:58085791-58085813 GGCCTCCAGCCAGACCAACCAGG + Intergenic
1139590901 16:67932236-67932258 ATCCACCAGTCAGAACACCCTGG - Exonic
1140215174 16:73001242-73001264 AGCCTCCAGCCAGCAGCTCTTGG + Intronic
1140266858 16:73428517-73428539 AGCCACCAGCGAGGACAGCCTGG + Intergenic
1141056186 16:80816707-80816729 AGTCCCCAGCCAGCACTTCCAGG - Intergenic
1142235733 16:88921639-88921661 AGCCTTAAGGCAGAACTTCCTGG - Intronic
1142243147 16:88956201-88956223 AGCCTCCAGACAGAATGGCCAGG + Intronic
1146630601 17:34466722-34466744 AGGCTCCAGACAAAACAGCCTGG + Intergenic
1147925467 17:43942900-43942922 AGGCTACAGCCAGAGCCTCCAGG + Intergenic
1148579330 17:48733003-48733025 AGCCTCCTGGCAGACCCTCCGGG + Intergenic
1148747374 17:49926237-49926259 AGTCTCCACCCAGAACTTCCGGG + Intergenic
1154205483 18:12333437-12333459 AGCCTCTAGCCTCAACTTCCTGG + Intronic
1154404976 18:14082760-14082782 AACCTCCAGCCTCAACCTCCTGG + Intronic
1156220266 18:35044087-35044109 GGACTCCACCCAGAACTTCCAGG - Intronic
1156487269 18:37474415-37474437 AGTCTCCTGCCAGAAGAACCTGG + Intronic
1156858845 18:41813690-41813712 AGACTTCTGCCTGAACATCCAGG + Intergenic
1160419436 18:78734030-78734052 GGCCTGCAGCCAGTGCATCCTGG - Intergenic
1160627176 18:80218776-80218798 AGACTTCTGCCTGAACATCCAGG + Intronic
1160788279 19:912006-912028 AGCCTCCCGCCAGAGGGTCCTGG - Intronic
1161649641 19:5476554-5476576 AGGCGCCCGCCATAACATCCGGG - Intergenic
1162035417 19:7935773-7935795 AGCCTCCAGCCACCACAGCTTGG + Intronic
1162333287 19:10043842-10043864 AGGCTCCAGCTAGAATATCCTGG - Intergenic
1163040726 19:14600121-14600143 ATTCTCCTGGCAGAACATCCGGG - Exonic
1163679760 19:18674237-18674259 GGCCACCAGTCATAACATCCTGG - Intergenic
1164598112 19:29543500-29543522 TCCCTCCAGCCAGCACATGCAGG - Intronic
1164628135 19:29743070-29743092 AGCCCCCAGCCCTAACACCCAGG + Intergenic
1164844861 19:31423386-31423408 AGCCACCAGCCAGGGCTTCCTGG - Intergenic
1166759086 19:45213287-45213309 AGCCGCCCGCCAGGAGATCCTGG - Exonic
1167344569 19:48937199-48937221 AGCCTACTGCCACAACACCCAGG + Intronic
1167613027 19:50516534-50516556 AGCCACCAGCCAGGACAGCCTGG + Intergenic
925422962 2:3726552-3726574 AGACTCCAACCAGAATGTCCTGG - Intronic
926140875 2:10367115-10367137 AATCTCCAGACAGAACACCCAGG - Intronic
926297968 2:11582174-11582196 AGCCTCCACCCTGAACAGCAGGG + Intronic
927108260 2:19845791-19845813 TGCCTACAGCTAGAACATCTTGG + Intergenic
929044627 2:37777701-37777723 AGCCTCCGGACAGATCATCCCGG - Intergenic
929053065 2:37854234-37854256 AACCTCCCCCCAAAACATCCTGG + Intergenic
929081615 2:38127707-38127729 AGACTCCCGCCTGGACATCCAGG - Intergenic
929485567 2:42350953-42350975 AGCCTTCATCCAGAACCTCCAGG + Exonic
930108579 2:47658800-47658822 ATCCTCCAACCAGAACACCATGG - Intergenic
930606994 2:53502959-53502981 AGCCTTCTGCCAGAACAGGCTGG + Intergenic
934175871 2:89580617-89580639 TGTCTCCAGCCACAATATCCTGG + Intergenic
934286182 2:91654979-91655001 TGTCTCCAGCCACAATATCCTGG + Intergenic
936738497 2:115475441-115475463 AGGCTTCTGCCAGGACATCCAGG - Intronic
937095219 2:119230915-119230937 AGTCTCCAACCAGGACAGCCTGG - Exonic
941431854 2:165422979-165423001 AGCCTTCTGCCTGGACATCCAGG + Intergenic
942114764 2:172717326-172717348 GACCTCGAGCCAGAACAACCGGG + Intergenic
942201179 2:173572975-173572997 ATCCTCCAGCCTGAGCCTCCAGG - Intergenic
943143953 2:184018426-184018448 AGACTTCTGCCTGAACATCCAGG - Intergenic
944685237 2:202112203-202112225 AGCTTCCAGCCACAACCTCCAGG + Intronic
945280134 2:208028089-208028111 AGGCACCAGCCACCACATCCGGG - Intergenic
945356295 2:208843519-208843541 AGACTTCAGCCTGGACATCCTGG - Intronic
946061999 2:216950433-216950455 AGCATCCAGCCAGAGCATCCAGG - Intergenic
946262113 2:218501610-218501632 TGCCTCCAGACAGAAAATCTGGG - Intronic
948524924 2:238565632-238565654 AGCCTCCAAGCAGAGCATCTGGG - Intergenic
948770722 2:240250184-240250206 AGCCCCCAGCCAGAACTCCCTGG - Intergenic
948966692 2:241387226-241387248 AGGCTCCAGCCAGAGCAGCTGGG + Intronic
1174112380 20:48205459-48205481 ACCCACCAGCCAGGACATCCAGG - Intergenic
1174168856 20:48604058-48604080 ACCCACCAGCCAGGACATCCAGG + Intergenic
1174426348 20:50434085-50434107 ACCCTCCTGCCATGACATCCTGG - Intergenic
1174596550 20:51688748-51688770 AGCCTCCAGCCAGAACATCCAGG + Intronic
1175388448 20:58611838-58611860 AGCCCCCGGCCAGAACCTGCAGG + Intergenic
1178908258 21:36653850-36653872 GCCCTCCAGGCAGAACATCAAGG - Intergenic
1180216286 21:46325228-46325250 GCACCCCAGCCAGAACATCCTGG - Intronic
1180820619 22:18824786-18824808 CGGCTCCAGCCAGGACAGCCTGG + Intergenic
1181082628 22:20424939-20424961 AGCCTCCAGCCAGAGGCACCAGG + Exonic
1181206842 22:21259258-21259280 CGGCTCCAGCCAGGACAGCCTGG + Intergenic
1182752569 22:32653620-32653642 AGCTTCCAGTCAGAAGATGCAGG + Intronic
1183271088 22:36862986-36863008 TGTCTTGAGCCAGAACATCCCGG + Intronic
1203220081 22_KI270731v1_random:36165-36187 CGGCTCCAGCCAGGACAGCCTGG - Intergenic
1203270745 22_KI270734v1_random:50661-50683 CGGCTCCAGCCAGGACAGCCTGG + Intergenic
950129802 3:10534230-10534252 AGCCTAGAGCCAGCACATCGGGG - Intronic
952842854 3:37662838-37662860 GGCCTCCAGCCACAACACCATGG - Intronic
952954820 3:38550404-38550426 AGCCACCAGCGATAACCTCCAGG - Exonic
953643661 3:44732896-44732918 ATACTCCAGCCTCAACATCCTGG + Intronic
953843385 3:46407448-46407470 AGCCTCCAGACCCAGCATCCGGG - Intronic
955683666 3:61528489-61528511 AGGCTCCCGCCACCACATCCAGG + Intergenic
955976442 3:64484866-64484888 AGCCTGCAGCTAGAAGACCCTGG - Intergenic
956401077 3:68880739-68880761 CGCCTCAAGCCAGCACCTCCGGG - Exonic
956447572 3:69340544-69340566 ATCCTGCAGTCAGAACACCCAGG + Intronic
959814773 3:110662560-110662582 AGACTTCTGCCTGAACATCCAGG - Intergenic
960849476 3:122037077-122037099 AGACTTCTGCCTGAACATCCAGG - Intergenic
961361903 3:126373359-126373381 GGCCACCAGCCAGAACCTGCAGG + Intergenic
961467549 3:127090760-127090782 ATCCTAGAACCAGAACATCCAGG - Intergenic
963359505 3:144252796-144252818 AGCCTCCTGCTAGATCATTCTGG + Intergenic
963803362 3:149698826-149698848 AGGCTGGAGCCAGAACAGCCAGG + Intronic
967567409 3:190988530-190988552 AGACTTCTGCCTGAACATCCTGG - Intergenic
968791844 4:2670532-2670554 AGCCTCGAGCCTGGACCTCCTGG + Intronic
970461290 4:16277249-16277271 AGACTTCTGCCAGGACATCCAGG - Intergenic
971005193 4:22365513-22365535 TGCCTGCAGCCTCAACATCCTGG - Intronic
972310107 4:37873299-37873321 AGCCTCCACCCAAAAAATACAGG + Intergenic
974816006 4:67004141-67004163 AGCCTGGAGCCAGAAAATCTGGG + Intergenic
976312169 4:83623182-83623204 AAACTCCAGCCTGGACATCCAGG - Intergenic
976354950 4:84106284-84106306 ATCCACAATCCAGAACATCCAGG - Intergenic
976949780 4:90813996-90814018 AGACTTCTGCCTGAACATCCAGG + Intronic
977891778 4:102320086-102320108 AGCCTGCAGACAGCAGATCCTGG + Intronic
985310111 4:188588607-188588629 AGCCTCCTGGGAGAGCATCCTGG - Intergenic
985617093 5:929606-929628 AGACTTCTGCCTGAACATCCAGG - Intergenic
985671695 5:1210115-1210137 AGCCTCCAGCAGGTGCATCCAGG - Intronic
985966114 5:3339919-3339941 AGCATCCAGGCAGAGCACCCTGG + Intergenic
987870775 5:23614335-23614357 AGCCTTCTGCCTGGACATCCAGG - Intergenic
989322996 5:40158920-40158942 GGCCTCCACCCTGGACATCCAGG - Intergenic
990083408 5:51944912-51944934 AGCCTTCTGCCTGGACATCCAGG - Intergenic
990494680 5:56335428-56335450 AGACTTCTGCCTGAACATCCAGG + Intergenic
990779930 5:59348972-59348994 ATCCTCCAGCCACAGCCTCCTGG - Intronic
991042816 5:62193387-62193409 AGGCTTCTGCCTGAACATCCAGG - Intergenic
993456296 5:88131153-88131175 AGACTTCTGCCTGAACATCCAGG + Intergenic
994320930 5:98393367-98393389 AGCCTCCACCCAGACCACCCAGG + Intergenic
994490444 5:100436226-100436248 AGCTTACAGACAGAAGATCCTGG + Intergenic
995673755 5:114638747-114638769 AGCCTAAAACCAGAACATTCAGG + Intergenic
998869841 5:146541219-146541241 AGTCTCCAGGAAGAACATTCTGG - Intergenic
999200149 5:149810459-149810481 AGCCACCTGCCAGGCCATCCAGG + Intronic
999202302 5:149825074-149825096 TGCCTTCTGCCAGAACAGCCCGG + Intronic
1002868538 6:1145776-1145798 AGCCTCCAACCGGGACTTCCTGG - Intergenic
1003072685 6:2957369-2957391 ATTCTCCACCCAGTACATCCTGG - Intronic
1006581536 6:35080419-35080441 AGCCCCAGGCCAGAACATGCAGG + Intronic
1007268674 6:40618714-40618736 TGCATCCAGCTAGAACATCGGGG - Intergenic
1007464794 6:42044178-42044200 AGGCTCCGGCCAGAACGTGCAGG - Intronic
1009435835 6:63617516-63617538 AGCTTCCAGAAAGAAAATCCAGG - Intergenic
1010517399 6:76789920-76789942 AGGCTTCTGCCTGAACATCCAGG + Intergenic
1011381030 6:86742410-86742432 TGGCTCCTGCCAGAACATGCTGG + Intergenic
1012811656 6:103966851-103966873 AGACTTCTGCCTGAACATCCAGG + Intergenic
1013254712 6:108372910-108372932 GCCCTCCATCCAGAACATCATGG + Intronic
1013398720 6:109770251-109770273 AAGCTCCAGCAAGAAAATCCAGG - Intronic
1015298035 6:131621001-131621023 AGAGACCAGCCAGGACATCCTGG - Intronic
1015882234 6:137881100-137881122 GGCCTCCTGCAAGAACATCCTGG + Exonic
1016216470 6:141609365-141609387 TGCCTCCAGGCAGAAAAGCCAGG + Intergenic
1016647369 6:146425535-146425557 ACCCTCTACCCAGAAGATCCTGG - Intronic
1018447099 6:163867785-163867807 AGTCTCCAGACAGAACTCCCAGG + Intergenic
1018902308 6:168057802-168057824 AGCCTCCAGCCCGAGCTTCTCGG + Intronic
1019308030 7:345427-345449 AGCCACCACACAGACCATCCTGG + Intergenic
1020023053 7:4880588-4880610 AGCCTCCAGGCAGCACACACTGG + Intronic
1020696550 7:11420530-11420552 AGACTTCTGCCAGGACATCCAGG - Intronic
1022099148 7:27158758-27158780 TGCGTCCTGCCAGAACCTCCTGG - Intergenic
1025721578 7:64020568-64020590 AGACTTCTGCCTGAACATCCAGG - Intergenic
1025743601 7:64223367-64223389 AGACTTCTGCCTGAACATCCAGG - Intronic
1026819941 7:73540482-73540504 AGCCTTCAGGCAGAACTCCCAGG - Intronic
1027395343 7:77747652-77747674 AGGCTTCTGCCTGAACATCCAGG - Intronic
1027809562 7:82877807-82877829 AGGCTCCCGCCACCACATCCGGG + Intronic
1028393855 7:90346241-90346263 AGTCTCCAGCCAAAGCTTCCAGG - Intronic
1031249120 7:119357062-119357084 AGACTTCTGCCTGAACATCCAGG + Intergenic
1034510691 7:151532222-151532244 AAACTTCTGCCAGAACATCCAGG + Intergenic
1035758537 8:2052218-2052240 AGCCTCCAGCCAGACGTCCCTGG + Exonic
1036480804 8:9137825-9137847 AGCCCCCAGCCAGCACACCTGGG - Exonic
1036761640 8:11513549-11513571 TGCCTCCAGCCCTAACATTCAGG - Intronic
1036769926 8:11571915-11571937 CGCCTCCAGCCAGAGCTTCTCGG + Intergenic
1036914690 8:12793640-12793662 AGGCTTCTGCCTGAACATCCAGG + Intergenic
1037946055 8:22990393-22990415 AGCCTGCAGGCAGGACATCTTGG + Intronic
1038976688 8:32705273-32705295 AGGCTCCAGCCACCACACCCGGG + Intronic
1041421623 8:57673113-57673135 AGGCTCCAGCCAAAGCATTCTGG + Intergenic
1044609315 8:94076754-94076776 ACCCTCCAGACAAAACAGCCTGG - Intergenic
1047533155 8:125695502-125695524 AGCTTCCAGCTAGAAAATGCAGG - Intergenic
1048213450 8:132476176-132476198 AGACTCCTGCCTGGACATCCAGG - Intronic
1049235858 8:141511942-141511964 AGGCTCCTGCCAGAACCTCTGGG + Intergenic
1049588183 8:143441451-143441473 AGACCCCAGCCAGCCCATCCTGG + Intronic
1049608533 8:143541260-143541282 AGCCGCCACCCAGAACACGCGGG + Intronic
1051996054 9:23219568-23219590 AGGATCCAGCCAGAAGCTCCCGG + Intergenic
1052863821 9:33453116-33453138 AGCCTCCTCCCAGAGCACCCAGG - Intergenic
1053084201 9:35204250-35204272 AGGCTTCAGCCTGGACATCCAGG - Intronic
1056105305 9:83341337-83341359 AGCCTCCATCCAGACGATCAGGG - Intronic
1057813183 9:98273490-98273512 AGCCTCCAACCATAACCTCAGGG - Intergenic
1057815164 9:98289081-98289103 GCCCTCTACCCAGAACATCCGGG - Exonic
1057998243 9:99840173-99840195 AGGCTCCAGCCAGATCCTCTGGG - Intronic
1059871651 9:118584801-118584823 AGCCTGCAGCCAGGGCATCGTGG - Intergenic
1062442758 9:136578499-136578521 AGCCTCCCGCCAGGAAATCAGGG - Intergenic
1062474125 9:136719136-136719158 CGCCCCCACCCACAACATCCCGG - Intronic
1185972292 X:4678742-4678764 AGCCTCCAGCCCCTACACCCAGG - Intergenic
1188134894 X:26483543-26483565 AATCTTCAGCCTGAACATCCAGG - Intergenic
1190776615 X:53557501-53557523 ATCCTCCACCCAGACCATCTAGG + Intronic
1191656562 X:63605018-63605040 AGACTTCTGCCTGAACATCCAGG - Intergenic
1193930558 X:87546464-87546486 AGCCCTCTGCCTGAACATCCAGG - Intronic
1194864424 X:99048559-99048581 AGCCTTCTGCCTGGACATCCAGG + Intergenic
1195931490 X:110081840-110081862 TGCCTCCAGGAAGAACATGCTGG - Intronic
1196524693 X:116718771-116718793 AGACTTCTGCCTGAACATCCAGG + Intergenic
1196925512 X:120630004-120630026 CGCCTGCAGCTAGAACAGCCTGG - Exonic