ID: 1174597410

View in Genome Browser
Species Human (GRCh38)
Location 20:51695123-51695145
Sequence CCCTTATCTGGCATGATCGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 39
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 37}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1174597410 Original CRISPR CCCTTATCTGGCATGATCGG AGG (reversed) Intronic
903064955 1:20694336-20694358 CCCTCCTCTGGCAGGATCTGAGG - Intronic
1077515256 11:2997690-2997712 CCCTTAGCTGGCATCTTTGGGGG + Intergenic
1077836759 11:5933075-5933097 CCATTCTCTGGCAGGAACGGGGG + Intronic
1085294131 11:75421166-75421188 CCCTAATCTGGGATAATCGGCGG + Intronic
1098291990 12:68965266-68965288 CCCTTGTCTGGCATGGTCATAGG - Intronic
1102192483 12:110999141-110999163 CCCTTGACTGGCATGACCAGAGG - Intergenic
1113562860 13:111297489-111297511 CCATTATGTAGCATGATTGGAGG - Intronic
1119631528 14:76236495-76236517 CCCTCATCTGTCATGCTCTGGGG + Intronic
1124403307 15:29369929-29369951 CCTTTATCTGCCATGTTTGGAGG + Intronic
1132036049 15:98485901-98485923 CCCTTCTCTTGCAGGATCAGAGG + Exonic
1136507394 16:30713646-30713668 CCCCTAACTGGCATGATTGAGGG + Exonic
1138755882 16:59484578-59484600 CCCTTGTCTAGAATGATGGGAGG + Intergenic
1144083695 17:11787555-11787577 CCTTTATCTGGCTTGATCCCAGG + Intronic
1145109852 17:20152981-20153003 CCCTAATCTAGCAGGATAGGTGG - Intronic
1151742875 17:75995834-75995856 CACTAATCTAGCATGTTCGGAGG + Intronic
933613808 2:84463299-84463321 CCCAGGTCTGGCATGATCTGTGG - Intergenic
942133116 2:172899994-172900016 CAGTTATCTGGCATGAGGGGAGG - Intronic
945574575 2:211514709-211514731 CCCTTATCTGAAATGCTTGGGGG + Intronic
1173410128 20:42802736-42802758 CCCTTCTCCTGCATGATCAGTGG + Intronic
1174597410 20:51695123-51695145 CCCTTATCTGGCATGATCGGAGG - Intronic
1179957186 21:44748061-44748083 CCCTTGTCTGGCATGAGCTTAGG + Intergenic
1182837545 22:33356351-33356373 CCATTCTCTGGCATGATCCAAGG + Intronic
949821910 3:8124955-8124977 CCCTTACCTGGCATGACCTTAGG + Intergenic
955506563 3:59638784-59638806 CTCTTACCTGGCATAATGGGTGG - Intergenic
983792209 4:171812964-171812986 CCCCTACCTGGCCTGAACGGCGG + Intronic
989473807 5:41851484-41851506 CCCTTACCTGGTATGATAGAAGG - Intronic
1016713742 6:147202079-147202101 TCCTTATCCGGCATGATCTATGG + Intergenic
1027720521 7:81735919-81735941 CCTTAATCTGGTAGGATCGGAGG - Intronic
1031459362 7:122027114-122027136 CACTTAGCTGTCATGATCAGGGG + Intronic
1033077456 7:138262889-138262911 CCCTCTTCTGGCATGATGTGGGG + Intergenic
1033313114 7:140276862-140276884 CCTTTATCTGGCCTGATAGCGGG - Intergenic
1038369652 8:26975620-26975642 CCCTGATCTGATATGATTGGTGG - Intergenic
1038403469 8:27304458-27304480 ACCTGAGCTGGCAAGATCGGGGG - Intronic
1038734531 8:30156742-30156764 CCCTTCTCCCGCATAATCGGCGG + Intronic
1044465737 8:92502318-92502340 CTTTCATCTGGCATCATCGGTGG - Intergenic
1050345334 9:4680056-4680078 CCCTTTTATGGCATCTTCGGAGG + Intronic
1188543242 X:31272473-31272495 CGCTTATTTGGCACAATCGGTGG - Intronic
1189588154 X:42482700-42482722 CCTTTAGCTTGCATGATTGGTGG - Intergenic
1195087693 X:101427926-101427948 CCCTAATGTGGCATGTTGGGAGG - Intronic