ID: 1174597569

View in Genome Browser
Species Human (GRCh38)
Location 20:51696227-51696249
Sequence GCCCCAACCCACCGAGGGGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 126
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 118}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1174597569 Original CRISPR GCCCCAACCCACCGAGGGGT TGG (reversed) Intronic
900529370 1:3145184-3145206 GCTCAAACCCAAAGAGGGGTGGG - Intronic
901131116 1:6962928-6962950 GCCCCAACTGAAAGAGGGGTGGG - Intronic
901815992 1:11793934-11793956 GCCCCAGCCCACGATGGGGTCGG + Exonic
912832623 1:112967247-112967269 GCTTGAACCCACCGAGGGGGCGG - Intergenic
914989500 1:152486083-152486105 GCCCCAACCCAACAAGTGATAGG - Intergenic
915309073 1:154998335-154998357 GCACCAGGGCACCGAGGGGTAGG - Intergenic
915338017 1:155159001-155159023 GCCCCACCCCTTAGAGGGGTGGG + Intergenic
919159228 1:193806920-193806942 CCCCCAATCCACCCAGGGTTGGG + Intergenic
1065687799 10:28303068-28303090 GCCCCCACCCTCGGAGGGGCGGG + Intronic
1070791506 10:79192222-79192244 GACCCAACCCACACAGGGCTGGG - Intronic
1070809934 10:79292663-79292685 CCCCCAACTCACCAAGGAGTGGG + Intronic
1076845738 10:133068699-133068721 GCCCCCACACACCCAGGGGGAGG - Intergenic
1077330853 11:1983275-1983297 GCCCCCACTCTCCAAGGGGTCGG - Intronic
1081531111 11:43959934-43959956 GCCCCAACCCACAGGAGGCTTGG + Intergenic
1081864801 11:46353638-46353660 CCCCCATACCACCCAGGGGTCGG + Intronic
1083938166 11:65881220-65881242 TACCCAGCCCACCGAGGGTTGGG - Intronic
1084757446 11:71248807-71248829 TCCCCAACCCAGCGTGGGGTGGG - Intronic
1085596389 11:77814386-77814408 GCCCCAACCTCCCGAGTAGTTGG - Intronic
1089338010 11:117738746-117738768 GCTCCAGACCACAGAGGGGTGGG - Intronic
1202813833 11_KI270721v1_random:38454-38476 GCCCCCACTCTCCAAGGGGTCGG - Intergenic
1094676101 12:32621754-32621776 GCCCAAACCCACCATGAGGTAGG - Intronic
1096243940 12:49974094-49974116 GCCCCAACCAACCCACTGGTGGG + Intronic
1101915532 12:108892915-108892937 GCCCCATCCCACCAAGAGGGTGG - Intronic
1103590286 12:121987294-121987316 GCCCCTGCCCAGCGAGAGGTGGG + Intronic
1104927432 12:132321098-132321120 TCCACAACCCACCCAGGGGGCGG + Intronic
1119825436 14:77653754-77653776 GCCCCAAACCAGCCAGGAGTTGG - Intergenic
1122768831 14:104088094-104088116 GCTCCAACCTCACGAGGGGTTGG - Intronic
1122995568 14:105262034-105262056 GCCCCAACCCACCAAGGGCAAGG + Intronic
1124381866 15:29173651-29173673 GCCCCAACCCTCCGAGGTGCTGG - Intronic
1124937729 15:34188022-34188044 GCCCCAACCTACCGAGCAGCTGG - Intronic
1131476650 15:92745689-92745711 GCCCCAGCCTCCCGAGGAGTTGG - Intronic
1132696057 16:1202464-1202486 GCCCCACCCCACGGAGGAGGCGG + Intronic
1136293422 16:29289223-29289245 CCCCCACCCCACCCAGTGGTTGG + Intergenic
1142037506 16:87870796-87870818 GCCCCACCCCAGGGAGGGGGCGG + Intergenic
1142104811 16:88296845-88296867 CCCACACCCCACCGAGGGGAGGG + Intergenic
1142168449 16:88606568-88606590 GCCTCAGCCCACCGAGTAGTTGG + Intronic
1142677292 17:1521711-1521733 GCCCCACCCCACCTATGGGCAGG - Intronic
1143530046 17:7497534-7497556 GCTCCAATACACAGAGGGGTGGG - Intronic
1147930704 17:43978802-43978824 GCCCCAACCCAGCCAAGGGGTGG - Intronic
1148163058 17:45462554-45462576 GCCCTAACCCAGCTAGGGGGTGG - Intronic
1150394287 17:64809209-64809231 GCCCTAACCCAGCTAGGGGGTGG - Intergenic
1160578425 18:79870033-79870055 GCCCCCAGCCACCTGGGGGTGGG + Intronic
1161048984 19:2151983-2152005 TCCCCCACCCACCCAGGAGTTGG - Intronic
1161327475 19:3670663-3670685 GCCCCCTCCCACCCAGGGCTGGG - Intronic
1161380617 19:3963318-3963340 GCCAAAACCCAGCGTGGGGTCGG + Intronic
1162180400 19:8865156-8865178 TCCCCAAACCACCAAGGGGAGGG - Intronic
1162372775 19:10289225-10289247 GCCCCCACCCACCGAGCAGAAGG + Intergenic
1163007514 19:14406073-14406095 GGCCCCGCCCACCGGGGGGTCGG + Intronic
1163305038 19:16472340-16472362 GTCCCGACCCTCCGCGGGGTGGG - Intergenic
1164824866 19:31277762-31277784 GCCCCAGCCCCCCGCGGGATGGG - Exonic
925043527 2:752713-752735 GCTCTGACCCACCGCGGGGTGGG + Intergenic
930693881 2:54391448-54391470 GCCCCAGGCCTCAGAGGGGTGGG + Intergenic
932028414 2:68158114-68158136 GCCCGTCCCCACAGAGGGGTGGG - Exonic
932189087 2:69724003-69724025 GCCTCAGCCCACCGAGGAGCTGG - Intronic
932887037 2:75557776-75557798 GCCCCCAGCCACAGAGGGGCAGG - Intronic
933195402 2:79383657-79383679 GCCCAAAACCACCTAGGGCTCGG - Intronic
935581297 2:104758120-104758142 ACCCCACCCCACCCAGGGGATGG + Intergenic
940460493 2:153958220-153958242 TCCCCAACCCACTGAGAGTTGGG + Intronic
942243980 2:173990510-173990532 GCCCACATCCACAGAGGGGTAGG - Intergenic
947388949 2:229620640-229620662 GCCCCATCCCAGTGTGGGGTTGG - Intronic
947711448 2:232318689-232318711 GCCCCAACCCACCCCAGGGGAGG + Intronic
1169003140 20:2182830-2182852 GCCCCAGCTCACACAGGGGTTGG + Intergenic
1169128821 20:3151988-3152010 GCCCCAGCCCCCCGAGTGGCTGG - Intronic
1172097548 20:32467731-32467753 CCCCCAGCCCAGCAAGGGGTTGG + Intronic
1174597569 20:51696227-51696249 GCCCCAACCCACCGAGGGGTTGG - Intronic
1178661496 21:34510909-34510931 GCCCCCACCCTCCCAGGGGCAGG - Intergenic
1182114754 22:27749795-27749817 GCCTCATCCCTCCCAGGGGTGGG + Exonic
1182604734 22:31494421-31494443 GCCCCAACCCCCCGAGTAGCCGG + Intronic
1183467118 22:37985372-37985394 CCCCCACCCCAACAAGGGGTGGG + Intronic
1184533618 22:45071886-45071908 CCCCCACCCCACAGAGGGGTGGG - Intergenic
1184860660 22:47171635-47171657 ACCCCAACACACAGAGGGCTTGG - Intronic
949859448 3:8492175-8492197 TGCCCAACCCAGCGAGGGGAAGG + Intergenic
951898878 3:27637323-27637345 GCCCCAGCCCCCCGAGTGGCTGG + Intergenic
952794988 3:37231118-37231140 GCCTCAGCCTCCCGAGGGGTTGG + Intergenic
953088986 3:39704907-39704929 ATCCCCACCCACCGAGGGATGGG - Intergenic
953457309 3:43053487-43053509 GCCGCACCCCACCGAAGGCTGGG + Intronic
954450479 3:50568959-50568981 GCCCGAGCCCACCAGGGGGTCGG - Intronic
954664332 3:52243834-52243856 TCCCCAACCCACCCCTGGGTGGG - Intergenic
954915793 3:54147919-54147941 GCCTCAGCCCCCCGAGGAGTTGG + Intronic
961458494 3:127035973-127035995 CCCCCAGCCCACTGAGGGGGTGG + Exonic
961653199 3:128427656-128427678 GCCCCTACTCACCTAGGGCTTGG + Intergenic
968629230 4:1641668-1641690 CCACCAACCCATCGAGGGCTCGG + Intronic
969417137 4:7068200-7068222 GGCCCCGCCCACCGGGGGGTGGG - Intergenic
970333233 4:15004511-15004533 CTCCCAACCCACCGGGGGCTGGG - Intronic
975765999 4:77668317-77668339 GCCTCAACCCCCCGAGTAGTTGG + Intergenic
976293314 4:83444494-83444516 GCCCCAACCTCCCGAGTAGTTGG + Intronic
977976276 4:103270408-103270430 GACCCAATCCACTGAGGGTTTGG - Intergenic
983715742 4:170778987-170779009 GCCTCAACCTCCCGAGTGGTTGG - Intergenic
985626506 5:991677-991699 CCCCCAACCCCAGGAGGGGTAGG + Intergenic
986296626 5:6444703-6444725 AGCCCAAGCCACTGAGGGGTGGG - Intergenic
987644124 5:20647709-20647731 GCTCCAACCCACGGGGGGATGGG - Intergenic
987731716 5:21781607-21781629 GCCTCAACCCACCGAGTAGCTGG - Intronic
992097894 5:73380106-73380128 ACCCCAACCCACCTCGGGGCAGG + Intergenic
992397473 5:76381183-76381205 GCCCAGACCCACAGAGGTGTGGG + Intergenic
995650956 5:114367665-114367687 ACCCCACCCCACAGTGGGGTTGG + Intronic
997862057 5:137427198-137427220 CCCCCAACCCACTGAGGTGCTGG + Intronic
998097229 5:139402977-139402999 GCCCCAACCCAGCCTGGGGAAGG + Intronic
998462549 5:142320496-142320518 GCCCCAGCACACGGAAGGGTGGG + Intronic
999247263 5:150161804-150161826 GCCCCAGCCCCTGGAGGGGTAGG + Intergenic
1001396202 5:171420756-171420778 GCCCGCAGCCAGCGAGGGGTAGG + Intronic
1002449581 5:179311042-179311064 CCCCCAACCCACCGAGTGCAGGG + Intronic
1003640493 6:7871516-7871538 GCCCAAACCCACCTATGGCTGGG + Intronic
1006828456 6:36954364-36954386 GACCCTACCCACAGAGGAGTGGG - Intronic
1019094294 6:169566372-169566394 CCCCCAACCCACAGAGGGGCCGG + Intronic
1019735826 7:2649364-2649386 GCCCCACCCCACCTAGGAGAGGG + Intronic
1020112513 7:5455556-5455578 GCCCATTCCCACCGAGGGGATGG - Intronic
1027063637 7:75105387-75105409 GCCTCAACCCCCCGAGTAGTTGG - Intronic
1034925637 7:155119183-155119205 GCCCCAACTAACAGAGGGGCAGG + Intergenic
1035239273 7:157519471-157519493 GCCACACCCCACCCAGGGGAGGG - Intergenic
1035261664 7:157665488-157665510 GCTCCATCCCACTGAGGGCTGGG + Intronic
1036618127 8:10404406-10404428 CCCCCAACCCTCCGTGGGGAGGG + Intronic
1036618130 8:10404408-10404430 GCCCCTCCCCACGGAGGGTTGGG - Intronic
1038672016 8:29590316-29590338 TCACAAACCCCCCGAGGGGTGGG + Intergenic
1040109841 8:43562438-43562460 CCCCCCACCCACCCTGGGGTAGG + Intergenic
1049113466 8:140664912-140664934 GCCAGCACCCACCGAGAGGTAGG - Exonic
1049849515 8:144823304-144823326 GCCCCAGCCCTCCGTGAGGTGGG + Intergenic
1051720558 9:20032790-20032812 GACCCAACCCAGGGAGGAGTGGG + Intergenic
1055422940 9:76162801-76162823 ACCCCTACCCCCAGAGGGGTAGG - Intronic
1055736714 9:79338047-79338069 GCCCCAAGCCACCAAGAGGTAGG + Intergenic
1060529843 9:124341690-124341712 GCCCCAACCCACCCAGGAGCTGG - Intronic
1060997381 9:127882863-127882885 GCCCCCTCCCAAGGAGGGGTGGG + Intergenic
1061009596 9:127947045-127947067 GCCCCAACCCCCAGAGGAGATGG - Intronic
1061033889 9:128102816-128102838 GCCCCCTCCCACCGGGGGGAAGG - Intronic
1061808377 9:133148882-133148904 GCCCACACCCACCGGGGGGAGGG - Intronic
1062353276 9:136149351-136149373 AACCCAACGCACTGAGGGGTGGG - Intergenic
1200279362 X:154763256-154763278 GTCCCACGCCACCGCGGGGTGGG - Intronic