ID: 1174600164

View in Genome Browser
Species Human (GRCh38)
Location 20:51718009-51718031
Sequence TCATTGGTATGCATGTTAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 115
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 109}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1174600164_1174600166 -9 Left 1174600164 20:51718009-51718031 CCTCCTAACATGCATACCAATGA 0: 1
1: 0
2: 0
3: 5
4: 109
Right 1174600166 20:51718023-51718045 TACCAATGATAGTGTAAATGAGG 0: 1
1: 0
2: 0
3: 9
4: 132
1174600164_1174600168 -2 Left 1174600164 20:51718009-51718031 CCTCCTAACATGCATACCAATGA 0: 1
1: 0
2: 0
3: 5
4: 109
Right 1174600168 20:51718030-51718052 GATAGTGTAAATGAGGCTGCAGG 0: 1
1: 0
2: 2
3: 13
4: 143
1174600164_1174600169 -1 Left 1174600164 20:51718009-51718031 CCTCCTAACATGCATACCAATGA 0: 1
1: 0
2: 0
3: 5
4: 109
Right 1174600169 20:51718031-51718053 ATAGTGTAAATGAGGCTGCAGGG 0: 1
1: 0
2: 0
3: 30
4: 210

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1174600164 Original CRISPR TCATTGGTATGCATGTTAGG AGG (reversed) Intronic
903184046 1:21619543-21619565 ACATAGGTATGCATGGGAGGTGG - Intronic
908014500 1:59816540-59816562 TCATTGATTTACATGTGAGGTGG + Intronic
910183968 1:84515042-84515064 TCACTGGTATGCAAATTAGTAGG - Intergenic
910625971 1:89306948-89306970 ACATAGGTATGCATATTAGCCGG + Intergenic
914690017 1:150017501-150017523 TAATTGGAATGCAGGTCAGGTGG + Intergenic
916450905 1:164919551-164919573 TCATTGCTTTGCATGTTAAAAGG - Intergenic
918147112 1:181766598-181766620 TCATTGGGATGCAGGTGAGCTGG + Exonic
918729822 1:187978762-187978784 TCATTGGTATGCGTTATAGATGG + Intergenic
919150323 1:193688979-193689001 TCATATGTATGCATTTTTGGGGG - Intergenic
924214132 1:241802584-241802606 TCATTGATATGCATGCTAATAGG + Intergenic
1068668979 10:59705640-59705662 TCATAGGAATGCAGGTTTGGGGG + Intronic
1073764262 10:106664761-106664783 TCTTTGGTATTGATGATAGGAGG - Intronic
1080962863 11:37180657-37180679 TCCTGGGTATGCATGTTAAGAGG + Intergenic
1081788799 11:45768115-45768137 TCATGGGTCTGCAGGTTAGTTGG + Intergenic
1086026461 11:82298122-82298144 TCTTTGGTATGCATCTAAGGAGG - Intergenic
1087634670 11:100688440-100688462 TCATTGGGATGAAAGTTAAGGGG + Intronic
1090640686 11:128726554-128726576 CCATTGGTATGGAGCTTAGGCGG - Intronic
1095396176 12:41764847-41764869 ACATTGGTGAGCATGTTGGGTGG + Intergenic
1100731957 12:97480535-97480557 GCTTTGGGTTGCATGTTAGGTGG - Intergenic
1102444349 12:112990259-112990281 TGATTTGTATACATTTTAGGGGG + Intronic
1102680970 12:114690421-114690443 TCATTGGTAGTGTTGTTAGGTGG + Intergenic
1103073937 12:117967506-117967528 TCAGTGATATACATGTCAGGAGG - Intronic
1107402107 13:40079532-40079554 TTATTGGTATCCATGTTGAGAGG - Intergenic
1109415791 13:62037777-62037799 AAATTGCTATGCATGTTAAGAGG + Intergenic
1114992604 14:28306127-28306149 TCATTGGTATGCAGGTCTGCTGG - Intergenic
1115158028 14:30362378-30362400 GCTATGGTATGCATTTTAGGTGG - Intergenic
1118634639 14:67736476-67736498 TCATTTGTATGCATGGTGTGAGG - Intronic
1119126362 14:72130864-72130886 GCATTGGTATGTGTGTTGGGGGG + Intronic
1121730752 14:96185454-96185476 TTATTGGTAGGCAGGTGAGGAGG + Intergenic
1121947494 14:98137066-98137088 CTCTGGGTATGCATGTTAGGGGG + Intergenic
1124666466 15:31597433-31597455 TAATTCGTATGCATGGTAGGAGG + Intronic
1125798600 15:42424226-42424248 TCATTAGCATGCTTGGTAGGGGG - Intronic
1126613372 15:50551900-50551922 TCATAGGTGTTCATGTTGGGAGG - Intergenic
1130892802 15:88147851-88147873 TCATTGGTGGGCATGTTTGCTGG - Intronic
1133891862 16:9886797-9886819 TAATTGGTATTCATGTCAGGGGG + Intronic
1138034292 16:53588273-53588295 TCATTGTTATGCGTGTGAAGTGG - Intergenic
1139604622 16:68009303-68009325 TCCATGGTATGCGTGTTGGGGGG + Intronic
1140564729 16:76027883-76027905 TCATTGGAATGGATTTAAGGAGG + Intergenic
1141305927 16:82864302-82864324 ACAATCATATGCATGTTAGGAGG + Intronic
1148587681 17:48792381-48792403 ACATTTGTGTGCATGTGAGGTGG - Intronic
1149284058 17:55142347-55142369 TACTTGGTATGCATTTTGGGAGG + Intronic
1150034159 17:61775566-61775588 TCAATGCTTTGAATGTTAGGAGG + Intronic
1150550087 17:66202281-66202303 TCACTGGAAGGCATTTTAGGGGG - Intergenic
1151418092 17:73979837-73979859 TCATTGGAGTCCTTGTTAGGAGG - Intergenic
1155408095 18:25512485-25512507 TCATTGGAATTGATGCTAGGTGG - Intergenic
1156200662 18:34827826-34827848 TCATTTGTATGCATTTAAAGAGG + Intronic
1158487678 18:57882115-57882137 TGATTGGTATACATGTCATGAGG + Intergenic
1158516587 18:58135708-58135730 TCATTGGTATTCCTGGTACGTGG + Intronic
1165747839 19:38240858-38240880 TCATTGGTTAGCATGGTTGGAGG - Intergenic
1167808059 19:51803435-51803457 TCCTTGGTATTCATGTTGAGTGG - Intronic
930115234 2:47712517-47712539 TGCATGGTATCCATGTTAGGAGG + Intronic
930196050 2:48511526-48511548 TTATTGTTATGCATTTCAGGAGG + Intronic
941373021 2:164691179-164691201 TCCTTGGTGTGTATGTGAGGAGG - Intronic
941463681 2:165800426-165800448 TAATTTTTATGCATGTTAGAAGG + Intergenic
943462266 2:188184004-188184026 TCATTGGTATGTATGTATAGGGG - Intergenic
945500930 2:210573995-210574017 TCATTGCTGTACATGTTAGCAGG - Intronic
947165697 2:227259652-227259674 TCATAGGTTTACATGTTAGCAGG - Intronic
948724586 2:239926034-239926056 TCATTGGTGGGAATGTAAGGTGG + Intronic
1174600164 20:51718009-51718031 TCATTGGTATGCATGTTAGGAGG - Intronic
1174765252 20:53247507-53247529 TAATTGGCATGCATGTTGGCAGG - Intronic
1175118571 20:56701397-56701419 TCATTAGTATTCCTGTTAGTAGG + Intergenic
1176334126 21:5579886-5579908 TCACCAGTGTGCATGTTAGGAGG + Intergenic
1176393631 21:6241066-6241088 TCACCAGTGTGCATGTTAGGAGG - Intergenic
1176467788 21:7075108-7075130 TCACCAGTGTGCATGTTAGGAGG + Intronic
1176491349 21:7456886-7456908 TCACCAGTGTGCATGTTAGGAGG + Intergenic
1176509293 21:7681497-7681519 TCACCAGTGTGCATGTTAGGAGG - Intergenic
1179717540 21:43297611-43297633 TCATTGACCTGCATGTTACGAGG + Intergenic
1181303897 22:21903183-21903205 TATTTGCTCTGCATGTTAGGAGG + Intergenic
1182912776 22:34001130-34001152 TCATTAATAAGCATGTTGGGAGG + Intergenic
1183337403 22:37257884-37257906 TGATTGATTTCCATGTTAGGGGG + Intergenic
949502816 3:4698099-4698121 TCTGTGGTATGCTTGTTATGTGG - Intronic
949614781 3:5741137-5741159 TCATTTGCCTGCATGTCAGGAGG - Intergenic
949917059 3:8973315-8973337 CCATTGATCTCCATGTTAGGAGG + Intergenic
950507959 3:13407413-13407435 TCATTGGGAGGCCTGTGAGGAGG - Intronic
951224126 3:20100845-20100867 TCAGTGGTAGGCATGATAGCAGG + Intronic
953915545 3:46918224-46918246 TCATAGGTATGTATGTAAAGGGG - Intergenic
957614342 3:82508245-82508267 TCATTGATGAGCATTTTAGGTGG + Intergenic
960117028 3:113905433-113905455 TGATTGGGATGCAAGTTTGGGGG + Intronic
961323736 3:126097294-126097316 TCCTGGGCATGCATGTTAAGAGG - Intronic
970808860 4:20067458-20067480 TCATTGCTATTCATTTTTGGTGG - Intergenic
971232799 4:24813670-24813692 TGATTGATATGCATGGTATGTGG + Intronic
971967555 4:33579917-33579939 TCATTAGTATGAGTGTTAGTGGG + Intergenic
974908237 4:68083071-68083093 TCATGGGTATGCAGCTTATGTGG - Intronic
976763015 4:88570166-88570188 TCATTGGCATGCATAGTATGAGG + Intronic
977677212 4:99761080-99761102 TCATTGATATGCATTTGAGTTGG + Intergenic
982553187 4:156827990-156828012 TCTTTGGCCTGCATGTTCGGAGG - Intronic
986021676 5:3810196-3810218 TCATTGCTATACATCTTAGTGGG - Intergenic
995399767 5:111727768-111727790 TCTTTGGTATTCCTTTTAGGAGG + Intronic
1002794402 6:459900-459922 TCATAGGTATGCATGTGTGAAGG - Intergenic
1011130898 6:84051126-84051148 ACGATGGTATGCATGTTAAGGGG - Intronic
1011448643 6:87470283-87470305 TCATTGGAATGTGTTTTAGGTGG + Intronic
1025852303 7:65253293-65253315 TCATTGTAATGAATGTTTGGAGG + Intergenic
1027934463 7:84585652-84585674 TAATTTGTCTGCATCTTAGGAGG + Intergenic
1029504500 7:100954476-100954498 TCATTGGAAAGCTTGTCAGGAGG - Exonic
1034854405 7:154528486-154528508 TCATTGTTTTGTATGTAAGGTGG + Intronic
1036968657 8:13329337-13329359 TCATTGGGATGCATAGAAGGGGG + Intronic
1041174609 8:55181568-55181590 TAATTTGTATGCATTTTAGAAGG + Intronic
1041987975 8:63949182-63949204 TCATTGTTATGTATTTTAGGTGG - Intergenic
1044027917 8:87196683-87196705 TCATTAGTATCCATGTGGGGTGG - Intronic
1044463828 8:92480804-92480826 TCATTGGTATGAATGAGTGGAGG + Intergenic
1047883227 8:129219259-129219281 TCATTCTAATGCATGTCAGGTGG - Intergenic
1049919716 9:351988-352010 TGATTCATATGCATGTTTGGTGG + Intronic
1051575295 9:18608434-18608456 TCATTTCTATGCATGTGAGTGGG + Intronic
1052651362 9:31306963-31306985 TCATTCATGTGAATGTTAGGTGG - Intergenic
1057865690 9:98678725-98678747 TCACTGGCATGAATTTTAGGAGG - Intronic
1058667652 9:107335492-107335514 CCCTTGGTATGCGTGTTTGGAGG + Intergenic
1059849745 9:118324471-118324493 TCCTTGGTATGTAAGTTAAGGGG + Intergenic
1187301680 X:18057143-18057165 TCAGTGATAAGCATCTTAGGTGG + Intergenic
1188192433 X:27188430-27188452 TTATTGGTATTCATGTTAAATGG - Intergenic
1191838585 X:65491994-65492016 TCTTTCTTATGCCTGTTAGGAGG - Intronic
1194074569 X:89372646-89372668 TCAGTGGAATGCAGTTTAGGAGG - Intergenic
1196345882 X:114658269-114658291 TCATTGCTATCCTTGTTAGAAGG - Intronic
1198368001 X:135962311-135962333 TCATTGATATGCATATTCTGCGG + Exonic
1200730081 Y:6725342-6725364 TCAGTGGAATGCAGTTTAGGAGG + Intergenic
1201727277 Y:17167588-17167610 TCATTGGGCTGGCTGTTAGGGGG + Intergenic