ID: 1174600981

View in Genome Browser
Species Human (GRCh38)
Location 20:51724624-51724646
Sequence CTGTGGGGCTGACATTCAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 243
Summary {0: 1, 1: 0, 2: 1, 3: 25, 4: 216}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1174600981 Original CRISPR CTGTGGGGCTGACATTCAGA AGG (reversed) Intronic
900605614 1:3522363-3522385 CTGAGGGGGTGACAGCCAGAGGG + Intronic
902184901 1:14717741-14717763 CTGTGGGGCTGACATGGAAGGGG + Intronic
902399557 1:16150590-16150612 CAGAAGGGCTGACAGTCAGAGGG - Intronic
902433951 1:16384911-16384933 CTGTGGGGCAGCGATTCATAGGG + Intronic
902795567 1:18798792-18798814 CTCTGGGGCTGCCATTCCCAGGG - Intergenic
905805254 1:40872135-40872157 ATGTGGAGCTGATATTCTGATGG + Intergenic
907818930 1:57947798-57947820 GTGTAAGGCTGACATACAGAAGG + Intronic
909198523 1:72658435-72658457 CTATGGGTCTGCAATTCAGAAGG - Intergenic
911046814 1:93635613-93635635 CTCTGGGGCCCACATGCAGAGGG - Intronic
912745130 1:112239697-112239719 CTGTGGGAGTGACATGCAGTGGG + Intergenic
912775765 1:112505576-112505598 TTGTGGGGCTGCCAGGCAGAGGG - Intronic
913262511 1:117012389-117012411 GAGTGGGGCTGGCATTCAAAGGG + Intronic
915592982 1:156881077-156881099 CTCTGGAGCTGAGAGTCAGAGGG + Intronic
915727213 1:158026226-158026248 CTGTGCCTCTGAGATTCAGAGGG - Intronic
916048436 1:161018192-161018214 CTGTGGGGCAGAGATCCAGAGGG - Intronic
917968717 1:180194159-180194181 CTGTGGGGCTGGCAGCCTGAAGG + Intronic
918111072 1:181455964-181455986 CTGTGGGACTGAGGTTCGGATGG + Intronic
918324242 1:183394639-183394661 ATCTGGGGCTGACAGTCAGGTGG - Intronic
918471814 1:184883095-184883117 CTGTGGGACTGACACTCTCAGGG + Intronic
918715034 1:187775345-187775367 CTTTGTGGCTGAGATCCAGAAGG + Intergenic
920050713 1:203163078-203163100 CTGTGGGGAACACATTGAGATGG + Intronic
924211266 1:241769753-241769775 CTGTGAGGCTGACATGGTGAGGG - Intronic
1063523764 10:6764347-6764369 CTGTGGGGCTTACATTTTGGAGG - Intergenic
1064130608 10:12706373-12706395 CTGTGGTACTGAATTTCAGAAGG - Intronic
1066704873 10:38166454-38166476 CTGTGGGGATGATGTTCATAGGG + Intergenic
1067724880 10:48762511-48762533 CTGTGGGTCAGGGATTCAGAAGG + Intronic
1070321172 10:75355776-75355798 CTATGGGTCTGGAATTCAGATGG + Intergenic
1070331609 10:75421563-75421585 CTGTGGAGCTTACTTTCAGTAGG + Intergenic
1070447876 10:76525488-76525510 CTGTGGAGCTTATATTCACACGG - Intronic
1070578948 10:77704280-77704302 CTTTGGGGATGACATTAAAAGGG + Intergenic
1070708246 10:78657245-78657267 TTGGGCGGCTGACATTCAGAAGG + Intergenic
1071204880 10:83263018-83263040 CTGTCAAGCTGACTTTCAGAGGG + Intergenic
1072196503 10:93121043-93121065 CTGCTGGACTGACATTCAAAGGG + Intergenic
1072616983 10:97056600-97056622 CCGTGGGGCAGACATCCAGAGGG - Intronic
1073434936 10:103510639-103510661 CTGAGGGGCTGAGACCCAGAGGG + Intronic
1073968572 10:109020153-109020175 CTTTGGCACTGGCATTCAGATGG + Intergenic
1075998339 10:126895785-126895807 CTGTGATGCTTACTTTCAGATGG + Intergenic
1076394384 10:130128252-130128274 TTGTGGGGCTGCTATACAGAGGG - Intergenic
1076519957 10:131075368-131075390 ATGTGAGGCTGACACTCTGAAGG - Intergenic
1076735272 10:132456170-132456192 CTGTGGGGGTGACAGTCATGGGG + Intergenic
1077043429 11:534447-534469 CTGTGGGTTTGCCCTTCAGATGG - Intronic
1078357973 11:10647031-10647053 CTGAGGGGCTGGCAGGCAGAAGG + Intronic
1078394816 11:10971789-10971811 TTGTGGAACTGAGATTCAGAAGG - Intergenic
1079133066 11:17760803-17760825 ATGAGGAGCTGCCATTCAGAGGG - Intronic
1079260253 11:18871755-18871777 CTTTGGTGCTGACATTGAAATGG - Intergenic
1080379777 11:31756309-31756331 CTGTAGGGCTTCCATTCTGAAGG - Intronic
1080689883 11:34547710-34547732 GAGTGGGGATGACATTCATAAGG - Intergenic
1080986811 11:37477517-37477539 GTCTGGGGCTGACAGGCAGAGGG - Intergenic
1081752538 11:45522194-45522216 CTGTGGGACTGAAAGTCAGGTGG - Intergenic
1083683591 11:64362441-64362463 CTGTGTGCCTGTCATTCAGATGG + Intronic
1084329923 11:68424268-68424290 CTGGGGGGCTGGCATGAAGACGG + Intronic
1085471955 11:76764129-76764151 CTGTAGGGCTGATACTCAGCTGG + Intergenic
1085667233 11:78425246-78425268 CGGTGAGGCTGTCATTTAGAAGG - Intergenic
1090665238 11:128910759-128910781 CTGTGGAGCTTACATTCTGATGG + Intronic
1091664867 12:2411824-2411846 CTTTGGGGCAGAGCTTCAGAAGG - Intronic
1091758847 12:3074195-3074217 CTGAGGGGCTGACAGTTGGAAGG - Intergenic
1092088266 12:5783677-5783699 CTGTTTGGCTGTCACTCAGAAGG + Intronic
1092090698 12:5801500-5801522 CTGTAGGGCTGATGTTCAGATGG - Intronic
1092194207 12:6539569-6539591 GTGTTGAGCTGACATTCAAATGG - Exonic
1093479445 12:19589782-19589804 CTGAGGGTCTTACATTAAGAGGG - Intronic
1099822440 12:87730018-87730040 CTGTGGGTCTGTCATTCCGCTGG - Intergenic
1101442814 12:104716142-104716164 CTCTGGGGCTGATATTCAAAGGG - Intronic
1101833081 12:108274492-108274514 ATGTGGGGTTGACAGTCAGCAGG + Intergenic
1101941989 12:109106084-109106106 CTGCAGGGCTGACATTTACAGGG + Intronic
1103017832 12:117509315-117509337 CTGTTTGCCTGGCATTCAGAGGG - Intronic
1104269118 12:127266501-127266523 ACATGGAGCTGACATTCAGATGG + Intergenic
1106115918 13:26817402-26817424 CTGGGGGGGTGACATAGAGACGG + Intergenic
1109554150 13:63948682-63948704 ATGTGGGGCTGACATATAGTTGG + Intergenic
1110718300 13:78732751-78732773 CCTTGGGGAGGACATTCAGAAGG - Intergenic
1112380266 13:98882344-98882366 CTGTGTGGCTGTCTTTGAGATGG + Intronic
1113808409 13:113123109-113123131 CCCTGGGGCTGAGAGTCAGACGG + Intronic
1117486646 14:56204556-56204578 CTGAAGTGCTGGCATTCAGAAGG + Intronic
1118042733 14:61935167-61935189 GGGTGGGGCTGTCAATCAGATGG + Intergenic
1120547063 14:85825138-85825160 CTGTGGAGCTTACATTCTGGTGG + Intergenic
1121521611 14:94589914-94589936 CTCTGGGGCTGCCATAAAGATGG + Intronic
1121733435 14:96202204-96202226 CTGTGGGGCTAAAGTACAGAGGG + Intergenic
1125310324 15:38372098-38372120 CTGTGGGTCTGGAATTCAGGAGG - Intergenic
1128412507 15:67413751-67413773 CTGGCGGGGTGACATTCAGTAGG - Intronic
1129332032 15:74832644-74832666 CTGTGGGGCTCAGATAGAGATGG + Intergenic
1130803036 15:87286700-87286722 CCATGGGGTTGACATTCAGAAGG + Intergenic
1131696903 15:94887283-94887305 CAGAGAGGCTGACAGTCAGATGG - Intergenic
1132714567 16:1284336-1284358 CTGTGGGGCTGACCTCCAACAGG + Intergenic
1133136085 16:3713020-3713042 CTGTGGTGCTGGCACTTAGACGG - Intronic
1136009639 16:27355110-27355132 TTGTGGAGCTGACATTCTGGAGG + Intronic
1137789583 16:51163850-51163872 ATGTGGGGCTGACAGTCTGGTGG - Intergenic
1137792794 16:51188981-51189003 CTGTGGGGCTGAGGTGTAGATGG - Intergenic
1138729435 16:59178580-59178602 CTGTGGGTCAGACATTCAACAGG + Intergenic
1140702074 16:77590149-77590171 TTGTGGGGTTGACATTCTTATGG - Intergenic
1140808869 16:78558074-78558096 ATGTGGGGCTGTGATTCTGAAGG + Intronic
1141482420 16:84315374-84315396 CTGTGGGGCTGACCTTCAAGTGG - Intronic
1143659875 17:8318327-8318349 CTGTGGCCCTGGGATTCAGAGGG - Intronic
1144794455 17:17881615-17881637 CTGTGGGCTTGACAGGCAGATGG - Intronic
1144875469 17:18394909-18394931 CTGTGGGGCTGACTCCCAGGAGG - Intergenic
1145156756 17:20549512-20549534 CTGTGGGGCTGACTCCCAGGAGG + Intergenic
1145798934 17:27671396-27671418 CTGTGGGGCTGACTCCCAGGAGG + Intergenic
1146160143 17:30555217-30555239 CTGTGGGGCTGACTCCCAGGAGG - Intergenic
1146263675 17:31437555-31437577 GTGTGGGGATGACACACAGATGG + Intronic
1146789144 17:35741833-35741855 CGGTGGTGCTGACAGTCAGAAGG - Exonic
1146844267 17:36173600-36173622 CTGTGGGGCTGACTCCCAGGAGG + Intronic
1146856572 17:36261535-36261557 CTGTGGGGCTGACTCCCAGGAGG + Intronic
1146864045 17:36326840-36326862 CTGTGGGGCTGACTCCCAGGAGG - Intronic
1146879840 17:36436531-36436553 CTGTGGGGCTGACTCCCAGGAGG + Intronic
1146883762 17:36457682-36457704 CTGTGGGGCTGACTCCCAGAAGG + Intergenic
1147066905 17:37927428-37927450 CTGTGGGGCTGACTCCCAGGAGG - Intronic
1147075366 17:37986070-37986092 CTGTGGGGCTGACTCCCAGGAGG + Intronic
1147078437 17:38006989-38007011 CTGTGGGGCTGACTCCCAGGAGG - Intronic
1147086891 17:38065616-38065638 CTGTGGGGCTGACTCCCAGGAGG + Intronic
1147094375 17:38130924-38130946 CTGTGGGGCTGACTCCCAGGAGG - Intergenic
1147102836 17:38189579-38189601 CTGTGGGGCTGACTCCCAGGAGG + Intergenic
1147620618 17:41864532-41864554 CTGTTGTGCTGACGTTCAAAAGG - Intronic
1148436398 17:47689280-47689302 CTGTGGAGCTCACATTCTGATGG + Intergenic
1148565408 17:48629665-48629687 CTGTGGGGGTGACTTTTGGAAGG + Intronic
1148911596 17:50945965-50945987 CTGTGGAGCTGACAGTCCAAGGG + Intergenic
1149847410 17:60016046-60016068 CTGTGGGGCTGACTCCCAGGAGG + Intergenic
1150085768 17:62272663-62272685 CTGTGGGGCTGACTCCCAGGAGG + Intronic
1151481986 17:74374987-74375009 CTGGGGGGCTGTCTTTCAGGAGG + Intergenic
1152339478 17:79716286-79716308 GTGTGGGGCTGACACCCAGGAGG + Intergenic
1152512287 17:80798521-80798543 CTCCGGGGCTGACATTTGGAGGG + Intronic
1153092862 18:1368598-1368620 CTGTGGGGCAGAAAGTCAAAAGG + Intergenic
1153161383 18:2208136-2208158 CTGTGAGGCTGACATTATGGAGG - Intergenic
1161454224 19:4362147-4362169 CTGTGAGGCTGAGACCCAGAGGG + Intronic
1161499538 19:4606274-4606296 TTGTAGAGCTGACATTCAAATGG - Intergenic
1162830028 19:13278626-13278648 TTGTGGGGCTGACATTTGGGTGG - Intronic
1165299968 19:34962595-34962617 CTGTGGGTCTGACAGACAGCAGG + Intronic
1166007844 19:39919376-39919398 TTGTGGAGCTGCCATTCTGATGG - Intronic
1166050274 19:40255121-40255143 CTGTGTGGCTGCCCTTGAGAGGG - Intronic
1166099063 19:40560290-40560312 CTGTGGAGCTGACATGCAGGCGG - Exonic
1166998097 19:46729410-46729432 CTGGGGGGCTGACATGTGGAAGG - Intronic
925530137 2:4850319-4850341 TTGTGGGGCTGACAGTTGGAGGG - Intergenic
927810830 2:26179469-26179491 CTGTGGGGCAGGCATGGAGAAGG + Intronic
929981424 2:46683783-46683805 CTGTGGCGGTAGCATTCAGAGGG - Intergenic
930278317 2:49339652-49339674 CTGTGAGGCTTACATGCAAAGGG - Intergenic
931250258 2:60524388-60524410 CTGGGGGGCTGCCATTCATTCGG + Intronic
932104002 2:68926495-68926517 CTGAGGGGCTGGGGTTCAGAAGG + Intergenic
932626880 2:73303955-73303977 CTGTGAAGCAGACATTGAGAGGG + Intergenic
933103090 2:78284568-78284590 CTGTAGGTCTTACTTTCAGAAGG + Intergenic
934845073 2:97657178-97657200 CTGCGGGGCTGAGATCTAGAAGG + Exonic
936707831 2:115097115-115097137 CTGTGTTGCAGACATTCAGTTGG + Intronic
937220897 2:120342874-120342896 AGGTGGGGCTGACAATGAGAAGG + Intergenic
938081791 2:128374105-128374127 CTGTGGGGCTGACACACACTTGG + Intergenic
939435310 2:142168665-142168687 CTTTGGGGTACACATTCAGAAGG - Intergenic
945659237 2:212665286-212665308 CTATAAGGCTGACATGCAGATGG + Intergenic
946021627 2:216644219-216644241 ATGTGGGGCTGGCAGCCAGAAGG - Intronic
947126900 2:226878719-226878741 CTGTGGGTCAGGAATTCAGAAGG - Intronic
948403665 2:237702055-237702077 CTGTGGGGCTGGCATTAATGTGG + Intronic
1170285660 20:14705550-14705572 CTGAGGGCCTGAAAATCAGAAGG + Intronic
1172600210 20:36178035-36178057 CTGTGATGCTGACAGCCAGAAGG + Exonic
1173423814 20:42926112-42926134 CTGTGGGTCTGACCTGCAGAGGG + Intronic
1173736924 20:45368548-45368570 CTGTAGGGCTGAGAGTCAGGAGG - Exonic
1174278667 20:49422281-49422303 GTGTGGGGCTGCCATGGAGATGG + Intronic
1174600981 20:51724624-51724646 CTGTGGGGCTGACATTCAGAAGG - Intronic
1175331740 20:58169303-58169325 CTGTGGGTCAGAAATCCAGATGG - Intergenic
1176135137 20:63519259-63519281 CAGTTGGGTTGACACTCAGAGGG - Intergenic
1177272104 21:18862682-18862704 ACGTGGGGCTGGAATTCAGAAGG - Intergenic
1179123104 21:38567026-38567048 CAGTGAGGCTGACATTCAGTAGG - Intronic
1179437682 21:41373576-41373598 CTGTGGGGCTGAAGGGCAGAGGG - Intronic
1179726286 21:43343239-43343261 CTGTGTGGGTGGCCTTCAGAGGG + Intergenic
1181272776 22:21669471-21669493 CTGTGTGGCTGACATATAGTAGG + Intronic
1182000365 22:26914893-26914915 CTGTGGGGTTTACACTCAGTGGG + Intergenic
1184749344 22:46475710-46475732 ATGTGGGAGTGACATTGAGAAGG - Intronic
1184781949 22:46654097-46654119 CGGTGTGGCTGGCATACAGAAGG - Intronic
950576898 3:13837430-13837452 TTCTGGAGCTGACATTCAGGAGG - Intronic
951107127 3:18757733-18757755 CTTTGGGGCTGGCATATAGAAGG + Intergenic
952559724 3:34577329-34577351 CTGAGAGGCTGACATTTAGTAGG + Intergenic
952873874 3:37925472-37925494 CTGTGGGGCCTGCATTCACAGGG + Intronic
953020433 3:39109607-39109629 CAGATGGGCTGACATTCAGAAGG + Intronic
956011298 3:64834418-64834440 TAGTGGGGCTGCCATTGAGATGG - Intergenic
956736746 3:72244274-72244296 CTGAGTGGCTGACTTTGAGATGG - Intergenic
959047828 3:101494233-101494255 CTCTGGGGCTGACATTTGAAAGG - Intronic
960454597 3:117854945-117854967 CTCTGGAGCTCACATACAGAGGG + Intergenic
962436943 3:135375454-135375476 CAGTGTGGCTGAAATCCAGATGG - Intergenic
964007599 3:151850744-151850766 TTGTGGGGTTGACATTCTCATGG + Intergenic
966030856 3:175346211-175346233 CTGTGTGGCAGAATTTCAGAAGG - Intronic
967560255 3:190909427-190909449 CTGTGCGCCAGACATTCAGGAGG - Intergenic
968839399 4:2991151-2991173 CTGTAGGGCGGACCGTCAGAAGG + Intronic
968953268 4:3705653-3705675 CTGTGTGGCTGACAATGGGATGG + Intergenic
968976692 4:3825790-3825812 CTGTGGGGCAGAAATTCAGGAGG - Intergenic
969563422 4:7963603-7963625 CTGGGGCTCTGAGATTCAGATGG + Intergenic
969832637 4:9810137-9810159 CTATGAGGCTGACATTCAAGTGG - Intronic
973295542 4:48515999-48516021 CTGTGGGGCTGCCACACAGCAGG + Intronic
976484700 4:85588062-85588084 CTGAGGGGATAACATGCAGAGGG + Intronic
979065645 4:116129248-116129270 CTGTAGTCCTAACATTCAGAAGG - Intergenic
981168660 4:141594558-141594580 CTGTAGGGCATAGATTCAGAAGG - Intergenic
981477718 4:145204598-145204620 CTGGGTGACTGACATACAGAGGG + Intergenic
982722045 4:158869249-158869271 CTGTGGGGATGACAACAAGAAGG + Exonic
985117158 4:186603674-186603696 CTGTTACGCTGACATTGAGAAGG + Exonic
987953949 5:24713487-24713509 CTGTGATGCTCACATTCAGATGG + Intergenic
990299229 5:54434053-54434075 CTGTGAGGCAGACATTGAGATGG + Intergenic
992022731 5:72640261-72640283 CTATGGGGCAGAAATTCAGATGG + Intergenic
992988178 5:82255105-82255127 CTGTGGGGTTGAGAAGCAGAGGG - Exonic
993941367 5:94062930-94062952 CTGTGGGGCTGCCATGCTTAGGG - Intronic
998063930 5:139141145-139141167 CTGTGGAGCTCCCAGTCAGATGG - Intronic
998631184 5:143900715-143900737 CTGTGGTGCTTACATTCCGTTGG + Intergenic
1000200956 5:159010705-159010727 CTGTGGAGCTGACATTGAGATGG - Intronic
1000618973 5:163460951-163460973 CCGTGGGGCTTACATTCAGGCGG + Intronic
1001098848 5:168797298-168797320 CTCTGGGGCTGCCAGTCAGGTGG + Intronic
1002399135 5:178981503-178981525 CGGTGGGGCTGGCCTTGAGAAGG - Exonic
1004317773 6:14605455-14605477 CTTTTTGGCTGACCTTCAGATGG - Intergenic
1004320989 6:14631296-14631318 CTGTGGGTCAGGCATTCAGCAGG + Intergenic
1008685701 6:53924241-53924263 CTGTGGGACTTGCATTCACATGG + Intergenic
1008839820 6:55889021-55889043 CTGTGGTGACGACTTTCAGAGGG + Intergenic
1008878375 6:56354186-56354208 CTGTGGGGCTAAAAGTCAGGTGG + Intronic
1013209391 6:107973263-107973285 CTGTGGGGCTGTCATTTATATGG + Intergenic
1016325483 6:142896502-142896524 ATGAGAGGCCGACATTCAGAGGG - Intronic
1016340319 6:143054920-143054942 CTGTGGGTAAGACATTCACAGGG + Intergenic
1016711476 6:147177687-147177709 TTGTAAGGCTGACCTTCAGAAGG + Intergenic
1018248326 6:161843230-161843252 ATGAGGGGCTGTTATTCAGAAGG - Intronic
1018379519 6:163245607-163245629 CTGTGAGGCTGAATTTGAGATGG - Intronic
1018625738 6:165777149-165777171 CTGCGGGGCTGGCATTGATAGGG + Intronic
1018647410 6:165961214-165961236 TTTTGGGACTGAAATTCAGAGGG - Intronic
1018723853 6:166595628-166595650 CTGAGGGGCTGAGATTCCTAAGG - Intronic
1022111634 7:27235819-27235841 CTGTGCGGGTGAGTTTCAGAGGG - Intergenic
1023311894 7:38895962-38895984 CGCTGGAGCTGACAGTCAGATGG - Intronic
1029576319 7:101405887-101405909 CTGTGGGGCTGGCTCTCAGGTGG + Intronic
1030686321 7:112490529-112490551 ATGTGGGGCTGAGAGTCAAAAGG + Exonic
1032019959 7:128401869-128401891 CTGTTGGCCTGACCCTCAGAGGG - Intronic
1034282947 7:149866195-149866217 CTGTGGGTCTGGCGGTCAGAGGG + Exonic
1034540520 7:151755201-151755223 CTGTGGGTGTGACAGACAGATGG - Intronic
1034730659 7:153384867-153384889 CTGTGGGGCTTACATTCTACTGG + Intergenic
1038514057 8:28169345-28169367 CTGTGGGTCAGAAATTCAGCAGG + Intronic
1038710907 8:29944442-29944464 CTGTGCTGCAGGCATTCAGAGGG + Intergenic
1040615085 8:49027281-49027303 TGGTGGGGCTGACCTTCAGCAGG - Intergenic
1041806537 8:61855649-61855671 CTGTGATCCTGACATTCGGAAGG - Intergenic
1044748688 8:95395697-95395719 CTGAGAGGCTGACTTTGAGAAGG + Intergenic
1045269171 8:100647619-100647641 CTGTGAGGCTGACATCCATAAGG + Intronic
1045397613 8:101776508-101776530 CTCTGGGGAGGACTTTCAGATGG + Intronic
1045477654 8:102567004-102567026 CTGTAGGTCAGAAATTCAGATGG + Intergenic
1047093132 8:121595293-121595315 CTGTGTGCCAGACATTCAAAAGG + Intergenic
1049261366 8:141640910-141640932 CTGGGGGGCTGCCAGTCAGATGG - Intergenic
1049699931 8:144005939-144005961 CTCTGGAGCTGACATTCTGGAGG - Intronic
1051177139 9:14372083-14372105 TGGCAGGGCTGACATTCAGATGG - Intronic
1054764414 9:69031577-69031599 CTGTGGGCCTGAAATTCACATGG + Intergenic
1060795946 9:126513438-126513460 CTGTGGTGATGACACACAGAAGG - Intergenic
1185813626 X:3133090-3133112 CAGTAGGGGTGACATTGAGAGGG + Intergenic
1189167047 X:38870585-38870607 CAGTGGGGCTGATCTTCACATGG + Intergenic
1189326288 X:40113519-40113541 CTGTGTGGTTGGCCTTCAGAGGG - Intronic
1189751546 X:44227795-44227817 CAGAGGGGCTTTCATTCAGAGGG - Intronic
1190032026 X:46983318-46983340 ACCTGGGGCTGACACTCAGAGGG - Intronic
1196052889 X:111324146-111324168 TTATGGGTCTGACATCCAGAAGG + Intronic
1196595264 X:117538629-117538651 CTTTGGTGCTGGCATACAGAAGG + Intergenic
1197374237 X:125663058-125663080 TTATGGAGCTGACATTCAAATGG - Intergenic
1201858525 Y:18571016-18571038 CTTTTGGGCTGACATTCTGGTGG + Intronic
1201874796 Y:18749365-18749387 CTTTTGGGCTGACATTCTGGTGG - Intronic