ID: 1174601914

View in Genome Browser
Species Human (GRCh38)
Location 20:51731837-51731859
Sequence CAGCTGTGACAGCATGGGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 345
Summary {0: 1, 1: 0, 2: 0, 3: 29, 4: 315}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1174601914_1174601927 21 Left 1174601914 20:51731837-51731859 CCCACCCCATGCTGTCACAGCTG 0: 1
1: 0
2: 0
3: 29
4: 315
Right 1174601927 20:51731881-51731903 TATAAAGGAAAAGGGGGAGCGGG 0: 1
1: 0
2: 3
3: 43
4: 542
1174601914_1174601926 20 Left 1174601914 20:51731837-51731859 CCCACCCCATGCTGTCACAGCTG 0: 1
1: 0
2: 0
3: 29
4: 315
Right 1174601926 20:51731880-51731902 ATATAAAGGAAAAGGGGGAGCGG 0: 1
1: 0
2: 4
3: 75
4: 831
1174601914_1174601920 6 Left 1174601914 20:51731837-51731859 CCCACCCCATGCTGTCACAGCTG 0: 1
1: 0
2: 0
3: 29
4: 315
Right 1174601920 20:51731866-51731888 CCACCAAGATTGCTATATAAAGG 0: 1
1: 0
2: 0
3: 9
4: 83
1174601914_1174601928 22 Left 1174601914 20:51731837-51731859 CCCACCCCATGCTGTCACAGCTG 0: 1
1: 0
2: 0
3: 29
4: 315
Right 1174601928 20:51731882-51731904 ATAAAGGAAAAGGGGGAGCGGGG 0: 1
1: 0
2: 4
3: 45
4: 698
1174601914_1174601929 23 Left 1174601914 20:51731837-51731859 CCCACCCCATGCTGTCACAGCTG 0: 1
1: 0
2: 0
3: 29
4: 315
Right 1174601929 20:51731883-51731905 TAAAGGAAAAGGGGGAGCGGGGG 0: 1
1: 0
2: 2
3: 42
4: 491
1174601914_1174601924 14 Left 1174601914 20:51731837-51731859 CCCACCCCATGCTGTCACAGCTG 0: 1
1: 0
2: 0
3: 29
4: 315
Right 1174601924 20:51731874-51731896 ATTGCTATATAAAGGAAAAGGGG 0: 1
1: 0
2: 3
3: 38
4: 449
1174601914_1174601922 12 Left 1174601914 20:51731837-51731859 CCCACCCCATGCTGTCACAGCTG 0: 1
1: 0
2: 0
3: 29
4: 315
Right 1174601922 20:51731872-51731894 AGATTGCTATATAAAGGAAAAGG 0: 1
1: 1
2: 2
3: 28
4: 356
1174601914_1174601923 13 Left 1174601914 20:51731837-51731859 CCCACCCCATGCTGTCACAGCTG 0: 1
1: 0
2: 0
3: 29
4: 315
Right 1174601923 20:51731873-51731895 GATTGCTATATAAAGGAAAAGGG 0: 1
1: 0
2: 3
3: 25
4: 412
1174601914_1174601925 15 Left 1174601914 20:51731837-51731859 CCCACCCCATGCTGTCACAGCTG 0: 1
1: 0
2: 0
3: 29
4: 315
Right 1174601925 20:51731875-51731897 TTGCTATATAAAGGAAAAGGGGG 0: 1
1: 0
2: 1
3: 28
4: 320

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1174601914 Original CRISPR CAGCTGTGACAGCATGGGGT GGG (reversed) Intronic
900339241 1:2180040-2180062 CAGCTGTGACCTCATGGAGAGGG + Intronic
900409928 1:2507898-2507920 CAGCTTTGACTTCATGTGGTGGG - Intergenic
900476930 1:2880332-2880354 CTGCTGCGGCAGCACGGGGTTGG + Intergenic
900565314 1:3329143-3329165 CTGCTGGGACAGGATGTGGTTGG - Intronic
902645729 1:17796651-17796673 TAGCTGTGAGAGCTGGGGGTTGG - Intronic
902694469 1:18130958-18130980 CAGCTCTGACAGCCTCGGGCCGG + Intronic
903101556 1:21035114-21035136 CAGCTGTGCCAGGGTGGGGGTGG - Intronic
903364897 1:22800078-22800100 CAGCTCTGACAGCAGGGTGTGGG - Intronic
903932981 1:26874701-26874723 GGGCTGTGACAAGATGGGGTGGG - Intergenic
904344144 1:29857125-29857147 CAGCTGTGGAGGCCTGGGGTTGG + Intergenic
904988995 1:34576339-34576361 CAGGTGTGGCAGCAGTGGGTAGG - Intergenic
906154832 1:43607847-43607869 CAGCTGTGCAAGGAAGGGGTAGG - Intronic
906223701 1:44103709-44103731 CAGCTCGGACAGCTTGGCGTTGG + Intergenic
906297947 1:44660444-44660466 CAGCTGGAGCAGCACGGGGTGGG - Intronic
906528077 1:46508107-46508129 GACCTGGGACAGGATGGGGTGGG - Intronic
909051523 1:70773918-70773940 TAGCTCTGACAGCATGTGGCTGG + Intergenic
909232283 1:73105878-73105900 CAGCTCGGACAGCTTGGTGTTGG - Intergenic
909610665 1:77548541-77548563 AAGCTGTTACAGCATGGTTTAGG - Intronic
909673254 1:78212046-78212068 CAGCAGTGTCATCATGGGGCAGG - Intergenic
910709369 1:90163655-90163677 TAGCTGTGAGGGAATGGGGTAGG - Intergenic
912823755 1:112887253-112887275 GAGCTGTGGGAGCCTGGGGTGGG - Intergenic
914932817 1:151949895-151949917 CAGCTCTGCCAGCGTGGCGTTGG + Intergenic
915240019 1:154514628-154514650 CAGGTGGGACAGCAGTGGGTTGG - Intronic
915602449 1:156930713-156930735 CTGCTGCCACAGCATGGGGCTGG - Intronic
917450993 1:175147107-175147129 CAGCTGTGGCAGCTTGGGGCGGG + Exonic
917660611 1:177173573-177173595 CTGCTCTGTCAGCATGGGGCTGG + Intronic
919687056 1:200493567-200493589 CAGCTGTGACAGCTGGGAGCAGG + Intergenic
919743145 1:200992462-200992484 CAGCTCTGAGGGCATGGGGCAGG + Intronic
921196316 1:212760733-212760755 CAGCAGTGACAGCAATGGGATGG - Intronic
922863325 1:228837920-228837942 CAGTTGTGACATAGTGGGGTTGG - Intergenic
923062717 1:230490602-230490624 CAGTTGTGGCAGGATGGGCTGGG + Intergenic
923626015 1:235614622-235614644 CAGCTGAGGCTGCATGGGGGTGG + Intronic
923660717 1:235954818-235954840 CAACAGTGAGAGCATGGTGTGGG - Intergenic
1066156015 10:32678752-32678774 GTGCTGTGACAGCTTGGGGAAGG + Intronic
1067173401 10:43925634-43925656 TAGCTGTGACCTCATGTGGTGGG + Intergenic
1067706640 10:48611261-48611283 CAGGTGTGACACCCTGGGCTAGG + Intronic
1067800239 10:49353670-49353692 CAGCTGTCACAACATGGGGAGGG - Intergenic
1068044707 10:51871541-51871563 CAGCACTGACAGCTTGGGGCTGG - Intronic
1068649674 10:59508274-59508296 GAACTGTGAAAGCATGAGGTTGG + Intergenic
1069554091 10:69385483-69385505 CAGCCCTGACAGCATGGAGCTGG - Intronic
1069692666 10:70364096-70364118 CAGCTCTGAGAGCATGGGGGAGG - Intronic
1071225715 10:83526226-83526248 CAGCTGGGCCAGGATTGGGTGGG + Intergenic
1072340432 10:94443055-94443077 CAGCTGTGCCAGGAAGGGTTAGG - Intronic
1072796737 10:98361725-98361747 CTTCTCTGACAGCCTGGGGTCGG + Intergenic
1073218637 10:101851493-101851515 CAGCTCTGACAGAAGGGGGTTGG + Intronic
1073442219 10:103558992-103559014 CCTCTGTGACAGGAGGGGGTGGG - Intronic
1073467737 10:103704197-103704219 CACCTGGGACAGAATGGGCTTGG + Intronic
1074676821 10:115860641-115860663 CAGCTGTGGCTGCATGCAGTTGG - Intronic
1075018161 10:118926417-118926439 CAGTTGTCACATCTTGGGGTGGG - Intergenic
1075621129 10:123929134-123929156 CAGAGGTGACAGGATGGGGCAGG + Intronic
1076519697 10:131073817-131073839 CAGTTGTGACAGAGTGGGCTGGG - Intergenic
1076737515 10:132465414-132465436 CAGCTGTGTAAGCACGGGGAGGG - Intergenic
1076942208 10:133617440-133617462 CAGCTGTGAACGCCTGGGCTGGG - Intergenic
1077406901 11:2386775-2386797 CAGCTGGGCCAGGAGGGGGTGGG - Intronic
1077730330 11:4723118-4723140 CAGCTCGGACAGCTTGGAGTTGG + Intronic
1079928571 11:26527904-26527926 CAGCTGTGAAAGCAGGGCATGGG - Intronic
1082813965 11:57496162-57496184 CAGCTGTGAGAGGAGGGGGCAGG + Exonic
1083151695 11:60795625-60795647 CAGCTGTCACAGCCTGGAGAGGG + Exonic
1083373684 11:62202606-62202628 AGGCTGTGCCAGCTTGGGGTGGG - Intergenic
1086986847 11:93260493-93260515 CTGTAGTGACAGCATGGGGGTGG + Intergenic
1087061365 11:93981720-93981742 CAGCTGTAACACAATGTGGTAGG + Intergenic
1089302797 11:117508617-117508639 GTGCTGTGACAGCAAGGGCTTGG - Intronic
1089556849 11:119319857-119319879 CTGCTGTGAGGACATGGGGTGGG + Intronic
1089625127 11:119746198-119746220 CAGTTGTGTGAGGATGGGGTAGG + Intergenic
1090511152 11:127376634-127376656 CAGCTGTGTGAGAATGGGTTTGG - Intergenic
1091551981 12:1542681-1542703 CAGCTGTGGCAACACAGGGTGGG - Intronic
1091563806 12:1633399-1633421 AAGCTGGGACTGGATGGGGTTGG - Intronic
1091713656 12:2760693-2760715 CAGCTGTCACAGCTGTGGGTTGG + Intergenic
1092124536 12:6066033-6066055 CAGATGTGTCAGCCTGGGCTGGG - Intronic
1092331059 12:7588563-7588585 CATCTGTGCCTGCATGAGGTGGG + Intergenic
1093124625 12:15313586-15313608 GAGCTGTGCCACCATGGGTTAGG + Intronic
1094491274 12:30962486-30962508 CAGCTCTGTGAGCATGGGGCAGG - Intronic
1095956893 12:47812110-47812132 CTGCTGTGCCAGCTTGGGGAGGG - Intronic
1098264703 12:68706675-68706697 CAGCTTGGACAGCTTGGTGTTGG - Intronic
1100023321 12:90097713-90097735 AAGCAGTCAGAGCATGGGGTTGG - Intergenic
1102577509 12:113865385-113865407 CAGATGTGACAGGCAGGGGTGGG - Intronic
1102663367 12:114548846-114548868 CTTCTCTGACAGCATGGTGTGGG - Intergenic
1106356429 13:28987636-28987658 CAGCTGGGACAGGATGGTGGTGG - Intronic
1106952857 13:34904529-34904551 CAGACGTGACAGCCTGGGGAAGG - Intergenic
1107808755 13:44179255-44179277 TGGATGTGACAGCATGGGGAAGG + Intergenic
1112051703 13:95649497-95649519 CAGCTGTCACAGGTTGGTGTTGG + Intergenic
1114349168 14:21831324-21831346 CAGCTTTCACAGAATGGAGTTGG + Intergenic
1114532245 14:23403306-23403328 CAGCAGGGACAGCAGTGGGTGGG + Intronic
1115315075 14:32016750-32016772 CAGGTGAGAGTGCATGGGGTGGG - Intronic
1115951625 14:38728077-38728099 CAGCTCGGACAGCTTGGTGTTGG - Intergenic
1116648999 14:47565855-47565877 CAGCTGTGACAATGTGGGGCAGG + Intronic
1117485783 14:56195425-56195447 CAGCTGTGAGGGGAGGGGGTAGG - Intronic
1117503366 14:56376056-56376078 CATCTGTGAAAGAAGGGGGTGGG - Intergenic
1118165630 14:63332752-63332774 CAGCTGTGGTAGTATGGGGAGGG - Intergenic
1118456090 14:65946746-65946768 CAGGTGGGACAGAATGGGGCAGG + Intergenic
1118709419 14:68507519-68507541 CAGGTGTGTGATCATGGGGTTGG - Intronic
1119978634 14:79054435-79054457 AAGCTGTAAATGCATGGGGTAGG - Intronic
1123457134 15:20436436-20436458 CAGCACAGAGAGCATGGGGTGGG + Intergenic
1123660928 15:22563923-22563945 CAGCACAGAGAGCATGGGGTGGG - Intergenic
1124263288 15:28211589-28211611 CAGCACAGAGAGCATGGGGTGGG + Intronic
1124314729 15:28658157-28658179 CAGCACAGAGAGCATGGGGTGGG - Intergenic
1124660699 15:31548721-31548743 CATCTGGGATAGGATGGGGTGGG - Intronic
1124874626 15:33580410-33580432 CAGCTGTGAGAGCATGACATTGG + Intronic
1126203322 15:46014642-46014664 CAGCAGTGACAGCAGTGGGCGGG + Intergenic
1126694977 15:51318095-51318117 CAGCTGTGACAGCCTTGTGAGGG - Intronic
1127173357 15:56327636-56327658 CTGCTGTGATGGCATGGGGGAGG - Intronic
1128842243 15:70859758-70859780 CAGCTCGGACAGCTTGGCGTTGG - Intronic
1130844968 15:87735744-87735766 CAGCTGTGAAAACATTGGCTGGG + Intergenic
1132418390 15:101642101-101642123 CAGCTGTGACTGCAGGAAGTGGG - Exonic
1132933786 16:2471281-2471303 GAGCTGTGCCAGGAGGGGGTGGG - Intergenic
1134264615 16:12682474-12682496 AAGCAGTGGCAGCCTGGGGTGGG + Intronic
1135171968 16:20192538-20192560 CAGCTGTGACAGCAACATGTGGG + Intergenic
1135469980 16:22721677-22721699 CAGATGTGGCAGCAGGGAGTTGG - Intergenic
1136342698 16:29655324-29655346 CAGCTGTGAGGCCATGGGGCTGG + Intergenic
1137677795 16:50312341-50312363 CAGCTGTGAGAGCATGGGCCTGG + Intronic
1138453466 16:57107156-57107178 CAGCTGTGCCAAGTTGGGGTGGG - Intronic
1138652385 16:58468090-58468112 CAGCTCTGACATCATGGGGAAGG + Intronic
1139576644 16:67846556-67846578 CAGCTGGGCCAGCTTGGGGCCGG + Intronic
1140753718 16:78048831-78048853 CAGCTTGGACAGCTTGGCGTTGG + Intronic
1141850287 16:86640458-86640480 CAGCCCAGACAGCAGGGGGTTGG + Intergenic
1141922971 16:87148382-87148404 CAGCTTTGCCAGCATGGAGTTGG + Intronic
1141936275 16:87240767-87240789 CAGATGTGGCAGAATGGGCTGGG + Intronic
1142715726 17:1745853-1745875 CAGGGGTGACAGGATGAGGTTGG - Exonic
1142964292 17:3571328-3571350 CAGCCGTGACAGCATGAGTGAGG + Intronic
1144192929 17:12862599-12862621 CATCTGTGAAATGATGGGGTTGG + Intronic
1144209687 17:13003701-13003723 CTGCTGTGAGAGCATGGCCTGGG - Intronic
1144779056 17:17798824-17798846 CTCCGGTGACAGCATGGGGAGGG - Intronic
1145126022 17:20300712-20300734 CAGCCGTGGCAGCATGCAGTGGG + Intronic
1145246873 17:21275378-21275400 TTGCTGGGAAAGCATGGGGTGGG + Intergenic
1146520517 17:33522132-33522154 CAGCAGTGACAGGAAGGAGTGGG - Intronic
1148771924 17:50072286-50072308 CAGATGAGACAGGATGGGGCCGG + Intronic
1148797893 17:50205995-50206017 CAGCGGTCAGAGAATGGGGTGGG - Intergenic
1149731638 17:58952331-58952353 GAGGTATGACAGCCTGGGGTGGG + Intronic
1149969644 17:61203964-61203986 CAGCTGTGAAAGAAGGGGGCCGG - Intronic
1150983427 17:70169267-70169289 CAGCTGGGACAGCAGCAGGTGGG - Intronic
1151159870 17:72156403-72156425 CAGGAATGACAGCATGGTGTCGG + Intergenic
1151212451 17:72554788-72554810 CAGGGGTGACAGGATGGGGTGGG - Intergenic
1151398485 17:73840559-73840581 CACCTGTGAAAGTAAGGGGTAGG + Intergenic
1151566894 17:74903667-74903689 CATCTCTGTGAGCATGGGGTGGG - Intergenic
1152523188 17:80872458-80872480 CAGCTGTCCCAGCACTGGGTCGG + Intronic
1152800698 17:82329478-82329500 CAGCCCTGACAGGGTGGGGTGGG - Intronic
1154295013 18:13140036-13140058 CAGCTGTGGCTTCATGGGGTGGG + Intergenic
1156113421 18:33756381-33756403 CAGCTGTGAGAGCATGACGTTGG + Intergenic
1156625171 18:38899905-38899927 CAGCCTTGACACCATGGGCTGGG + Intergenic
1157063555 18:44321169-44321191 CAGCTCGGACAGCTTGGTGTTGG + Intergenic
1159232049 18:65620557-65620579 CAGCTGTGTCAGCACAGGGGCGG + Intergenic
1159583821 18:70263622-70263644 CAACTGTGACAGCCCAGGGTAGG + Intergenic
1160447276 18:78937348-78937370 CAGCTGTGAAGGGATGGGGCTGG + Intergenic
1161042659 19:2118292-2118314 CAGGTGTGAGAGCCTGGGGCTGG - Intronic
1161079790 19:2305088-2305110 CTGCTGTGACAGCAGTGGCTGGG - Intronic
1161783399 19:6308528-6308550 CAGCTGTGTAACCATGGGGTGGG - Intronic
1164271000 19:23671562-23671584 CCCCTGTGCCACCATGGGGTTGG + Intronic
1164417580 19:28059482-28059504 CAGCTGTGAACACATGAGGTTGG + Intergenic
1164706609 19:30324783-30324805 CGGCTCTGACTTCATGGGGTAGG - Intronic
1164962183 19:32443097-32443119 CTGCACCGACAGCATGGGGTAGG - Intronic
1165044584 19:33094687-33094709 AAACTGTGACAGCTTGGGGGAGG - Intronic
1165108449 19:33487756-33487778 CAGTGGTGACAGGGTGGGGTGGG + Intronic
1165364702 19:35358413-35358435 CAGCTGAGACTGCATGAGGAGGG + Intergenic
1167534557 19:50041484-50041506 AAGCTGTGACAGCTGGGGCTGGG - Intronic
1167578682 19:50329691-50329713 CAGATGAGACTGCATGGGGCGGG + Intronic
925214541 2:2083396-2083418 CAGCTGTGACAGCGGGCTGTGGG - Intronic
925908827 2:8558002-8558024 TAGCTGTGCCAGCTTGGGGAAGG - Intergenic
925969587 2:9096982-9097004 CAGCTGTGCCAGCAGGGGTGGGG + Intergenic
926125667 2:10270293-10270315 AAGCTGTGACATGAGGGGGTTGG + Intergenic
927514953 2:23666818-23666840 CAGCTGTGACCACAGAGGGTCGG - Intronic
927533923 2:23837156-23837178 GGGCTGTGGCAGCAGGGGGTTGG + Intronic
933692196 2:85187697-85187719 TAACTGTGACAGCATGGTCTTGG - Intronic
934675305 2:96245659-96245681 CATCTGTGAGGGCGTGGGGTAGG + Intergenic
937066817 2:119023804-119023826 CAGCTGGGACTGCAGGTGGTGGG - Intergenic
937613623 2:123893581-123893603 CAGCTGTCACAGCAAAGGGATGG - Intergenic
938094338 2:128451788-128451810 CAGCGGTGACACTATGTGGTGGG - Intergenic
938180856 2:129180512-129180534 CTGCTGTGACAGGATGTGATGGG - Intergenic
938220969 2:129567454-129567476 CTCCTGTGACAGCATTGGATTGG + Intergenic
939007060 2:136801412-136801434 CATTTGAGACAGCATTGGGTAGG + Intronic
941172235 2:162153372-162153394 CATCAGTGACATCATGCGGTTGG - Intergenic
942558646 2:177198147-177198169 CAGCTCGGACAGCTTGGCGTTGG - Intergenic
945237074 2:207640902-207640924 AAACTGTAACAGCATAGGGTAGG + Intergenic
945791389 2:214309871-214309893 CAGCTGGGACAGCAGGTTGTGGG + Intronic
946063827 2:216968946-216968968 GGGATGTGACAGTATGGGGTGGG - Intergenic
946320879 2:218953774-218953796 CAGCTCAGACAGCTTGGTGTTGG + Intergenic
947474603 2:230431385-230431407 GTGCTGTGCCAGCCTGGGGTAGG + Intronic
947586160 2:231358203-231358225 CAGCAGGGACAGCAGGGAGTGGG + Intronic
948057009 2:235016113-235016135 TAGATGTCACAGCAAGGGGTGGG + Intronic
948132585 2:235611472-235611494 CATCTGTGATAACATGGGGTGGG + Intronic
948486658 2:238285616-238285638 AAGCTGTGACCTCATGAGGTGGG - Intronic
1171961524 20:31498241-31498263 CTGCTGTGAGAGCCTCGGGTGGG - Intergenic
1174601914 20:51731837-51731859 CAGCTGTGACAGCATGGGGTGGG - Intronic
1176865345 21:14048529-14048551 CAGAGATTACAGCATGGGGTTGG + Intergenic
1178693001 21:34765317-34765339 CAGCTTTGACAGCATGTCATGGG + Intergenic
1178959923 21:37056278-37056300 CAGCAGTGAGACCATGGGATAGG + Intergenic
1179254160 21:39700411-39700433 CAGGTGTGGGTGCATGGGGTGGG - Intergenic
1180002461 21:45001553-45001575 CAGCCGTGGCAGCAGGGGGTGGG + Intergenic
1180248029 21:46561516-46561538 CTGCTGTGAGCACATGGGGTGGG + Intronic
1180588342 22:16914005-16914027 CAGCAGTCACAGCCTGGGGAAGG - Intergenic
1180855394 22:19041874-19041896 CAGCAGTGACAGGATGAGGAAGG + Exonic
1182277746 22:29201158-29201180 CAGCTGTGAGTCCATGTGGTTGG - Intergenic
1182619616 22:31611704-31611726 CAGCCTAGACAGCCTGGGGTGGG - Intronic
1183467381 22:37986524-37986546 CAGCTGTGCCAGGATGGGGGTGG + Intronic
1184461274 22:44639551-44639573 CAGCTGGGACAGCCCGGGGAAGG + Intergenic
1184837925 22:47035116-47035138 CAGTTGCTACAGCAGGGGGTTGG - Intronic
1185046686 22:48531943-48531965 CAGCTGTGCCGGCATGTGCTGGG - Intronic
1185243012 22:49756437-49756459 CAGCTGTAACAGGAAGGGGCCGG - Intergenic
950012673 3:9734128-9734150 TAGATGTGACAGCATGGGGGTGG + Exonic
950628376 3:14265091-14265113 CAGCTGTGACAGGTTGGCGGGGG - Intergenic
951091289 3:18576697-18576719 AAGCTGTGACACCATGGGAAGGG - Intergenic
951522018 3:23619271-23619293 CAGCTGTCACCACATGGGGCTGG - Intergenic
951531959 3:23706250-23706272 CAGCTGTGACAGTCTGTGGCAGG - Intergenic
951557888 3:23938968-23938990 GAGCTGAAACAGCAGGGGGTTGG - Intronic
952611544 3:35216086-35216108 CAGCTCGGACAGCTTGGCGTTGG + Intergenic
953896897 3:46809950-46809972 CAGCTGACACAGCCTGGAGTGGG - Intronic
954851827 3:53607555-53607577 CAGCTGTGACAGCAAGAGTGGGG + Intronic
955221418 3:57026427-57026449 GAGCTGTGCAAGCGTGGGGTGGG - Intronic
955839480 3:63096756-63096778 CAGCTCGGACAGCTTGGCGTTGG + Intergenic
959131153 3:102357619-102357641 GATCTTTGAGAGCATGGGGTTGG + Intronic
960014577 3:112871956-112871978 CAGCAGTGTCAGCATTGGTTGGG + Intergenic
961021970 3:123515483-123515505 CAGCTGGAACAGCCTTGGGTGGG + Intronic
961092998 3:124131644-124131666 CAGCTGTGACATCAGGGTGTAGG + Intronic
961156734 3:124685941-124685963 GAACTTTGACAGCATGGGGGTGG - Intronic
961241717 3:125417141-125417163 CAGGTGTGGGAGCCTGGGGTTGG + Intergenic
961819037 3:129565861-129565883 AGGCTGTGACAGACTGGGGTGGG - Intronic
962712816 3:138101865-138101887 CAGCTCGGACAGCTTGGCGTTGG + Intronic
962883556 3:139601681-139601703 CTGCTCTCACAGGATGGGGTTGG + Intronic
964465920 3:156992309-156992331 ATGAGGTGACAGCATGGGGTTGG - Intronic
965416600 3:168402593-168402615 AAGCTTTGAAAGAATGGGGTTGG + Intergenic
965742510 3:171890558-171890580 CAGCCATTACAGGATGGGGTAGG + Intronic
966508473 3:180733899-180733921 AGGCTGTGTCAGCATAGGGTCGG - Intronic
967886919 3:194339594-194339616 CAGCTGTGACTACATGTGGATGG + Intergenic
967956780 3:194883469-194883491 CAGAGGTGACATCATGGGGCAGG + Intergenic
968235212 3:197027346-197027368 CAGGTGGGTGAGCATGGGGTAGG - Intronic
968634043 4:1668610-1668632 CCCCTGTGACAGCACGGGGGAGG + Intronic
968962107 4:3750910-3750932 CAGCTGTGACTGGATGGTGGGGG - Intergenic
969347123 4:6576483-6576505 CAGGTGTGTCTGCATGGGGTTGG - Intronic
969675856 4:8613983-8614005 CACCAGAGACAGCATGGGGGTGG + Intronic
973214565 4:47654867-47654889 GAGCTGTGCCTGCCTGGGGTTGG - Intronic
974113388 4:57551183-57551205 CAGCAGTGACAAAATGGGTTAGG - Intergenic
977928671 4:102729106-102729128 CAGCTTGGACAGCTTGGCGTTGG + Intronic
978710183 4:111770678-111770700 CAGCTGTGGCAGCACAGGGCTGG + Intergenic
979478156 4:121182777-121182799 CAGATGTGAAAGCATGGAGCTGG - Exonic
979561686 4:122108448-122108470 CAGCTGTAATAGCATGGAGAGGG - Intergenic
985492945 5:189783-189805 CCGCAGTGACAGCAGGGTGTTGG + Exonic
985953054 5:3237869-3237891 CAGCACTCACAGCATGGGGCAGG + Intergenic
987066049 5:14290855-14290877 CAGCCGAGACAGCATGTGGGTGG - Exonic
987171499 5:15263827-15263849 GAGCTGTGCCAGCTTGGGGGAGG - Intergenic
989591369 5:43116137-43116159 CAGCAGTAACAGCATGCAGTAGG - Intronic
990900488 5:60743939-60743961 CAGCTCAGACAGCTTGGCGTTGG + Intergenic
994320802 5:98392461-98392483 CAGCTCGGACAGCTTGCGGTTGG + Intergenic
994821244 5:104653178-104653200 CAGTAGTGACAGCAGTGGGTAGG - Intergenic
997274223 5:132570198-132570220 AAGCTGTGACAGCCTGGTGGGGG + Intronic
997842359 5:137253677-137253699 AAGCTGTGTGAGGATGGGGTAGG - Intronic
998895991 5:146800721-146800743 CAGCTGTGCTTGGATGGGGTAGG + Intronic
999424435 5:151474989-151475011 AAGCTCTGACATCATGGGGGAGG + Intronic
1001408777 5:171495661-171495683 CAGCTATGGCATCATGGGGGTGG + Intergenic
1003973716 6:11323384-11323406 CAGCTGGAAGAGCATGTGGTGGG + Intronic
1005720300 6:28594870-28594892 CAGATGTTACAGGATGGGGTGGG + Intronic
1006369422 6:33634701-33634723 AAGCTGTGCCAGCGTGGGCTCGG + Intronic
1006439435 6:34043878-34043900 CTGCTGTGACAGCACTGGGATGG - Intronic
1006742074 6:36316138-36316160 CTGCTGTCGCACCATGGGGTAGG - Exonic
1008234363 6:49026189-49026211 CCCCTGTCACAGCCTGGGGTGGG - Intergenic
1008443884 6:51565328-51565350 TAGCTGTCACAGCTTGGGGATGG - Intergenic
1008764920 6:54900294-54900316 CTGATATGCCAGCATGGGGTAGG - Intronic
1009412186 6:63378741-63378763 ATGCTCTGTCAGCATGGGGTGGG - Intergenic
1010177908 6:73051191-73051213 CAGCAGTGGCAGCGTGGGGCAGG - Intronic
1010657367 6:78526890-78526912 CAGATGTGACATAATGGGGTGGG + Intergenic
1010657409 6:78527311-78527333 CAGATGTGACATAATGGGGTGGG + Intergenic
1012309118 6:97699101-97699123 CAGCTGTGACAGCAATGTGTGGG + Intergenic
1014336775 6:120147227-120147249 CAGCTGTGAAAGGAAAGGGTTGG - Intergenic
1015539190 6:134297356-134297378 CAGCTCAGACAGCTTGGCGTTGG + Intronic
1015617667 6:135094450-135094472 CACATGAGACAGGATGGGGTGGG + Intronic
1016690340 6:146930557-146930579 CAGCTGTAACATCAGAGGGTAGG + Intergenic
1016944621 6:149518084-149518106 CAGCTGTGAGAGGAGAGGGTGGG + Intronic
1018317263 6:162569322-162569344 CAGCTTGGACAGCTTGGTGTTGG - Intronic
1018918813 6:168156499-168156521 CAGCTGGGACAGGATGGAGGAGG - Intergenic
1019036420 6:169063338-169063360 GAGCTGTGCCAGCCTGGGGATGG + Intergenic
1019683616 7:2367357-2367379 CTGGGGTGACGGCATGGGGTGGG - Intronic
1020115768 7:5475564-5475586 CAGCTGAGACAGCCTTGGGCTGG - Intronic
1020864383 7:13538863-13538885 GAGATGAGAAAGCATGGGGTGGG + Intergenic
1021471148 7:21003440-21003462 CAGCAGTGGCAGCAGTGGGTAGG - Intergenic
1021912404 7:25399567-25399589 CTGCTGTGACAGCCCAGGGTAGG + Intergenic
1022459980 7:30595417-30595439 GGGCTGTGACAGAATGGGGAAGG - Intronic
1022926116 7:35057716-35057738 CAGCTGTGACAGCTGGTGGCGGG - Intergenic
1023865179 7:44235039-44235061 TAGCTGTGTCAGGTTGGGGTGGG + Intronic
1024058341 7:45680484-45680506 CAGAAGTGACATCCTGGGGTCGG - Intronic
1026022289 7:66718406-66718428 CATCTGTGCCATCTTGGGGTTGG + Intronic
1029453957 7:100657902-100657924 CAGCTCTGACAACTTGGGGTAGG + Intergenic
1031994680 7:128222089-128222111 CAACTGTGACACCAAGGGGTGGG + Intergenic
1032109969 7:129067703-129067725 CAGTTGTGACATGCTGGGGTGGG + Intergenic
1033582711 7:142751658-142751680 CAGCTCTGGAGGCATGGGGTGGG - Intronic
1033585725 7:142773150-142773172 CAGCTCTGGAGGCATGGGGTGGG - Intergenic
1034487633 7:151375968-151375990 CAGCTTGGACAGCCTCGGGTGGG + Intronic
1034513347 7:151553757-151553779 CGGTTGTCACAGCTTGGGGTGGG - Intergenic
1034994818 7:155570958-155570980 CAGATGTGGCGACATGGGGTAGG - Intergenic
1035458263 7:159023516-159023538 CAGCAGTGTCTGCATCGGGTGGG - Intergenic
1035458314 7:159023711-159023733 CAGCAGTGTCTGCATCGGGTGGG - Intergenic
1036758236 8:11486107-11486129 GAGCTGTGCCAGCTTGGGATTGG - Intergenic
1039064748 8:33598761-33598783 CAGGTGTGAGAGGATGGGGAGGG - Intronic
1039459838 8:37735065-37735087 CAGCTGTGTCTGTTTGGGGTGGG + Exonic
1039479779 8:37863924-37863946 CAGCTGTGACAGCAAGTGCAGGG + Intronic
1042271541 8:66961502-66961524 CAGCTTGGACAGCTTGGTGTCGG + Exonic
1042947719 8:74171574-74171596 CAACAGTGACACCATGTGGTGGG + Intergenic
1043008136 8:74846211-74846233 CAGCTATTCCAGCATGGGGAGGG + Intronic
1048974334 8:139662630-139662652 CAGCTGGAAGAGCAGGGGGTGGG - Intronic
1048988908 8:139750049-139750071 CAGCTGAGATGGGATGGGGTGGG - Intronic
1050256496 9:3797465-3797487 CAGCAGTGTCAGCATGGCCTGGG + Intergenic
1050569181 9:6919918-6919940 CAGTTCTGATAGCATGGAGTAGG - Intronic
1050723157 9:8614295-8614317 TAGCTGTGACTGCATGTGTTGGG - Intronic
1051354843 9:16232108-16232130 CAGTGGTGACAGGATGGGGCAGG - Intronic
1051435488 9:17026595-17026617 AGGCTGTGACAGCGTGGGGCAGG + Intergenic
1053098940 9:35353086-35353108 GAGCTGTGACAGCATGATGGAGG + Intronic
1053277297 9:36793202-36793224 CAGGTGTAACAAAATGGGGTAGG + Intergenic
1053546343 9:39026920-39026942 CAGGTGAGACAGGATGGGGTGGG + Intergenic
1053810658 9:41848582-41848604 CAGGTGAGACAGGATGGGGTGGG + Intergenic
1054619935 9:67338857-67338879 CAGGTGAGACAGGATGGGGTGGG - Intergenic
1056547385 9:87624144-87624166 CAGCTGTGGCTGCAAGGAGTAGG - Intronic
1056601811 9:88052766-88052788 CAGCTGTGGCAGCTGGGGGTGGG - Intergenic
1057006938 9:91568920-91568942 CTTCTGTGAGGGCATGGGGTGGG - Intronic
1057943653 9:99306205-99306227 CAGCTCGGACAGCTTGGCGTTGG - Intergenic
1058439442 9:104993459-104993481 CAGCTGAGGCACCAAGGGGTTGG - Intergenic
1059207809 9:112483198-112483220 CAAAGGTGACAGCAGGGGGTTGG - Intronic
1059226923 9:112680983-112681005 CAGCAGAGGCAGCATGGTGTGGG + Intergenic
1060251107 9:121987449-121987471 CAGCTGTGACAGTGCAGGGTGGG - Intronic
1060839607 9:126783191-126783213 CAGGTGAGAGAGGATGGGGTTGG + Intergenic
1062391565 9:136335969-136335991 CATCGGTGACCGCATGGGGGAGG + Exonic
1062391646 9:136336282-136336304 CTGCAGTGTCAGCATGGGCTGGG - Intronic
1187042596 X:15612554-15612576 CAGATGGGCCAGCATTGGGTAGG - Intergenic
1187144210 X:16622766-16622788 CAGAGGTGACAGAAAGGGGTAGG + Intronic
1187173296 X:16871225-16871247 CAGCTCCGCCAGCTTGGGGTGGG - Intergenic
1187717907 X:22121886-22121908 CAGATGTAGCAGTATGGGGTGGG - Intronic
1188161756 X:26813722-26813744 CAGCTGCGACTGCATTGAGTCGG + Intergenic
1188451374 X:30310645-30310667 CAGCTGTGAAGACATGGGGCAGG + Intergenic
1190440287 X:50469790-50469812 CGGGGGTGACAGCAGGGGGTGGG - Intronic
1192201772 X:69070965-69070987 CAGCTCTGTCAGCATCCGGTGGG - Intergenic
1192314433 X:70041016-70041038 AAGCTGTAACAGAATGGGTTGGG - Exonic
1192846025 X:74907918-74907940 CAGCTGAGACAGCCTGAGGTGGG - Intronic
1192872145 X:75194881-75194903 CAGCAGTGTCAGTATGGGGGTGG + Intergenic
1192982964 X:76366854-76366876 CAGCAGTGGCAGCATGGCATGGG + Intergenic
1193566049 X:83078354-83078376 GAGCTGTGCCAGATTGGGGTAGG + Intergenic
1193749588 X:85326258-85326280 CAGCGGTGGCAGCATGGTGGTGG + Intronic
1197570758 X:128147601-128147623 CAGCAGTGACAGCCTGGCTTAGG - Intergenic
1197657098 X:129128386-129128408 CAGCTGTGACAGGTTGGTGGCGG - Intergenic
1197717077 X:129717317-129717339 GAGCTGGGACAGCCTGGGTTGGG + Intergenic
1197770287 X:130085102-130085124 GAGCTGTGCAAGCATGGGGCAGG - Intronic
1198143362 X:133828662-133828684 CAGTTATGAGAGCCTGGGGTGGG + Intronic
1198342945 X:135732543-135732565 CAGCAGTGACTGGCTGGGGTGGG + Intergenic
1198345044 X:135750752-135750774 CAGCAGTGACTGGCTGGGGTGGG - Intergenic
1198934878 X:141895242-141895264 CAGCAGAGGCAGCGTGGGGTGGG - Intronic
1199466865 X:148147777-148147799 CAGGTGTGAAAGCCTGTGGTGGG - Intergenic
1199523722 X:148768037-148768059 CAGAAGTGACAGCATGGAGGAGG - Intronic
1199608255 X:149593592-149593614 CAGCTGACACTGCATGGGGGAGG - Intronic
1199630865 X:149775768-149775790 CAGCTGACACTGCATGGGGGAGG + Intronic
1200249243 X:154543556-154543578 GCCTTGTGACAGCATGGGGTGGG + Intronic