ID: 1174607071

View in Genome Browser
Species Human (GRCh38)
Location 20:51768566-51768588
Sequence CATGGTGCGCCCGTGTCCGT CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 25
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 21}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1174607071 Original CRISPR CATGGTGCGCCCGTGTCCGT CGG (reversed) Exonic
1063115440 10:3068599-3068621 CCCGGCGCGCCCGCGTCCGTGGG - Intronic
1077305625 11:1867570-1867592 CATGATGAGCCCGGGTCCCTGGG + Intronic
1084640973 11:70425603-70425625 CATGGTGCAGCCGTTTCAGTGGG + Intronic
1109649877 13:65310895-65310917 CATGTTGCGCATGTGTCTGTAGG + Intergenic
1132758582 16:1497793-1497815 CATGGTGCACACGTGTGCGAGGG - Intronic
1158938506 18:62385667-62385689 CATGGTGGGACCGTGTCTCTGGG - Exonic
1161592297 19:5134331-5134353 CAGGGAGCGCCCGTGTCTGGTGG + Intronic
942108410 2:172656392-172656414 TGTGGTGAGCCCGTGTCCCTGGG + Intergenic
1171983035 20:31640336-31640358 CATGGTGCCCCCGGTCCCGTGGG + Intronic
1174607071 20:51768566-51768588 CATGGTGCGCCCGTGTCCGTCGG - Exonic
1182143459 22:27982356-27982378 CTCGGTGCGCCAGTGTCCGTTGG + Exonic
954758862 3:52859882-52859904 AATGGTGTGCCCGTGCCTGTGGG + Intronic
968729232 4:2261879-2261901 CATTGTGCGCCCGCGGCGGTGGG - Intronic
982291968 4:153790124-153790146 CATGGTGCCCCCTGGTACGTAGG - Intergenic
986277240 5:6287262-6287284 CTTGGTGGGCCTGTGTCTGTGGG - Intergenic
992166602 5:74058402-74058424 CATGGTGCGCACCTGTTAGTGGG - Intergenic
1020445173 7:8261431-8261453 CCTGGCGCGCCCGTTTCCTTTGG - Intronic
1029491901 7:100875306-100875328 CTTGGTGCGGCCGCGGCCGTTGG - Exonic
1032842725 7:135727041-135727063 CATGGTGCACCTGTGTTTGTCGG - Intronic
1036930608 8:12951972-12951994 CAGGGTGCGCGCGTGGCCGTGGG - Intronic
1039518249 8:38150759-38150781 CATGTTGCGCATGTGTCTGTAGG + Exonic
1042004792 8:64168873-64168895 CATGCTGCTCCCCTGTCCATGGG - Intergenic
1046238341 8:111457054-111457076 CATGGTGCTCCCTTGTCCACAGG - Intergenic
1056621263 9:88216835-88216857 CAGGGAGCCCCCGTGTCTGTAGG - Intergenic
1062191971 9:135252794-135252816 CTTGGTGAGCCTGTGTCCGTGGG - Intergenic