ID: 1174609931

View in Genome Browser
Species Human (GRCh38)
Location 20:51790684-51790706
Sequence CCGTTCCAGTGTAAGATCTG TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 84
Summary {0: 1, 1: 0, 2: 3, 3: 9, 4: 71}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1174609931_1174609934 -7 Left 1174609931 20:51790684-51790706 CCACAGATCTTACACTGGAACGG 0: 1
1: 0
2: 3
3: 9
4: 71
Right 1174609934 20:51790700-51790722 GGAACGGTCTCTCCCCGGTGTGG 0: 1
1: 0
2: 0
3: 10
4: 79
1174609931_1174609940 15 Left 1174609931 20:51790684-51790706 CCACAGATCTTACACTGGAACGG 0: 1
1: 0
2: 3
3: 9
4: 71
Right 1174609940 20:51790722-51790744 GGTGCGATAATGCATCTTGAGGG 0: 1
1: 0
2: 0
3: 3
4: 55
1174609931_1174609935 -6 Left 1174609931 20:51790684-51790706 CCACAGATCTTACACTGGAACGG 0: 1
1: 0
2: 3
3: 9
4: 71
Right 1174609935 20:51790701-51790723 GAACGGTCTCTCCCCGGTGTGGG 0: 1
1: 0
2: 0
3: 12
4: 61
1174609931_1174609939 14 Left 1174609931 20:51790684-51790706 CCACAGATCTTACACTGGAACGG 0: 1
1: 0
2: 3
3: 9
4: 71
Right 1174609939 20:51790721-51790743 GGGTGCGATAATGCATCTTGAGG 0: 1
1: 0
2: 0
3: 4
4: 44

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1174609931 Original CRISPR CCGTTCCAGTGTAAGATCTG TGG (reversed) Exonic
905398597 1:37685076-37685098 TCGTTCTAGGGTAAGATTTGGGG - Intronic
908085723 1:60631695-60631717 CCAGTCCAGTGTGAGATCTTGGG + Intergenic
913176560 1:116278045-116278067 CAGTTCCAGTGTCAAATCCGAGG - Intergenic
919856169 1:201707645-201707667 CTGTTCCAGTGTCAGAACAGGGG - Intronic
920951047 1:210572064-210572086 CCGTGCCAGTGTAACATTTACGG - Intronic
920976092 1:210786711-210786733 CAGTTCCATTTTTAGATCTGTGG - Intronic
923627856 1:235628600-235628622 CTGGTCCTGTGTAAGTTCTGGGG + Intronic
1062966748 10:1613147-1613169 CGTCTCCAGAGTAAGATCTGTGG + Intronic
1073463166 10:103678146-103678168 CCGTTCATGTGTAATGTCTGGGG + Intronic
1074182162 10:111075238-111075260 CCTTTCCAGTGTTAGTTCTGAGG - Intergenic
1075502865 10:122993847-122993869 CCTTTTCAGTGTAATATATGTGG - Exonic
1077257994 11:1597715-1597737 TGCTGCCAGTGTAAGATCTGAGG - Exonic
1077261091 11:1621405-1621427 TGCTGCCAGTGTAAGATCTGAGG - Exonic
1077262568 11:1630534-1630556 TGCTGCCAGTGTAAGATCTGAGG + Exonic
1079086019 11:17445520-17445542 CCATTCCCGTGTAAGCCCTGAGG - Intronic
1084798850 11:71527778-71527800 TGCTGCCAGTGTAAGATCTGAGG + Exonic
1084803992 11:71566176-71566198 TGCTGCCAGTGTAAGATCTGAGG + Exonic
1084806425 11:71582365-71582387 TGCTGCCAGTGTAAGATCTGAGG - Exonic
1088669975 11:112131421-112131443 CTGTTCCAGGGGAAGATCTGGGG - Intronic
1089044957 11:115492767-115492789 CAATTCCAGTCTAACATCTGAGG - Intronic
1105464613 13:20626639-20626661 CAGTGCCAGTGAGAGATCTGCGG - Intronic
1107230448 13:38103925-38103947 CCCTTTCAGGGTAGGATCTGTGG - Intergenic
1107389706 13:39951427-39951449 CTGATCCTGTGTAACATCTGTGG - Intergenic
1114364684 14:22013631-22013653 CTATTCCAGTATAAGATTTGTGG + Intergenic
1117218102 14:53572819-53572841 GAGTTCCAGTATAAGCTCTGTGG - Intergenic
1117896716 14:60495121-60495143 CTGTTCCAATGTAAGATCTATGG - Intronic
1119012561 14:71010205-71010227 CTGTGCCACTGTAAGATCTTCGG - Intronic
1120702692 14:87715225-87715247 CCCTTCCAGTCGAAGAGCTGGGG + Intergenic
1135167968 16:20157181-20157203 CCATTCCAATGTAAGATCTGTGG + Intergenic
1136171464 16:28492202-28492224 CCGCTCCAGTTTAAAACCTGCGG - Exonic
1136590321 16:31214587-31214609 CCCATCCAGTGTAGGATGTGAGG + Intronic
1136934538 16:34447513-34447535 CCTTTCCAGAGTAAAATCTTAGG - Intergenic
1136970034 16:34964301-34964323 CCTTTCCAGAGTAAAATCTTAGG + Intergenic
1137786231 16:51140003-51140025 CCCTTTAAGTGTAAGATCTGTGG - Exonic
1137786379 16:51140774-51140796 CCATTCAAGTGCAACATCTGCGG - Exonic
1139681093 16:68563880-68563902 CCCTTCCAGTGTAAGGAATGTGG + Exonic
1140047251 16:71449252-71449274 CCCTATCAGTGTAAGATGTGTGG - Exonic
1147342934 17:39765863-39765885 CCTTTCGAGTGTAACATGTGTGG - Exonic
1150239516 17:63621145-63621167 CTGTTCCAGTGTAATATGTCAGG - Intergenic
1156333753 18:36150303-36150325 CAGTTCCAGTGTCAGTTCTAGGG + Intronic
1160454920 18:78993330-78993352 CCCTTCAAGTGCAACATCTGCGG + Exonic
1160455097 18:78994107-78994129 CCGTTCAAGTGCAAGATCTGCGG + Exonic
1164045557 19:21536567-21536589 CCTTTCCAGTGTAAAAAATGTGG + Exonic
1168344793 19:55644911-55644933 CCCTTCGAGTGTGACATCTGTGG + Exonic
1168644995 19:58053959-58053981 CCCTTCCAGTGTAGCGTCTGCGG + Exonic
943404711 2:187465793-187465815 CAATTCCAGTGTCAGATTTGAGG + Exonic
944293919 2:198040558-198040580 CCGTTCTAGAGGAGGATCTGAGG + Intronic
944655509 2:201873249-201873271 CCCTCCCAGTGAAAGATCTCTGG - Intronic
946672771 2:222123978-222124000 CCATTCCAGTGTAAAATGTGTGG - Intergenic
947749978 2:232526836-232526858 CCCCTCCAGTGTCAGCTCTGCGG + Intronic
948595539 2:239077067-239077089 GCATTCCAGGGTAGGATCTGGGG - Intronic
1174609931 20:51790684-51790706 CCGTTCCAGTGTAAGATCTGTGG - Exonic
1175584287 20:60125739-60125761 CTGTTTCAGGATAAGATCTGCGG - Intergenic
949118270 3:355462-355484 AGGTTCCAGTGGAAGATTTGGGG - Intronic
949158937 3:858159-858181 CTGTTCTAGTGTAAGGTTTGTGG - Intergenic
953570306 3:44066073-44066095 CAGTTCCAGTGTAAGTTCCAGGG - Intergenic
953573768 3:44096166-44096188 CCATGCCAGTGAAAAATCTGTGG - Intergenic
959738931 3:109693743-109693765 GCTTTCCAGTGTCAGATGTGTGG + Intergenic
963046901 3:141109366-141109388 CCTTTCCACTGTAAGATGAGGGG - Intronic
963086916 3:141445497-141445519 CCATACCAGTGCAAGACCTGCGG + Exonic
966443381 3:179973311-179973333 CTGTTCCTGGGCAAGATCTGTGG - Intronic
982693407 4:158572772-158572794 CCGTTACAGTGCAGGAGCTGAGG - Exonic
990607409 5:57424104-57424126 TCATACCAGTGTGAGATCTGTGG + Intergenic
993482938 5:88447673-88447695 CTGGTCCAGGGTAAGGTCTGTGG - Intergenic
1000307632 5:160009798-160009820 CCCTTCCAGTGTAAGCTGAGTGG + Intronic
1002882584 6:1265986-1266008 TCGTTCCAGTGTAAGGTCAGTGG - Intergenic
1010665557 6:78625902-78625924 CTGTTCCAGGGTAAGATTTGAGG - Intergenic
1027467433 7:78533471-78533493 AGGTTCCAGTGTAATCTCTGAGG + Intronic
1027703391 7:81497568-81497590 CCATTCTAGTGGAATATCTGGGG + Intergenic
1029288928 7:99486892-99486914 CCTTTTGAGTGTAAGGTCTGTGG + Exonic
1035619955 8:1029199-1029221 CGGTTCCAGTGCAGGCTCTGTGG - Intergenic
1039344060 8:36684517-36684539 TTGTTCCAATGTAAGATCTCAGG + Intergenic
1042316238 8:67429136-67429158 CAGTACCTGTGTAAGATCTGTGG - Intronic
1044753674 8:95439941-95439963 ACTTTCCTGTGCAAGATCTGAGG + Intergenic
1045408114 8:101888033-101888055 CAGTCCCAGTGAAAGTTCTGAGG + Intronic
1056272781 9:84963007-84963029 GCTTTCCAGTGTCAGAGCTGTGG + Intronic
1058815635 9:108680485-108680507 CCCTTCCCGTGAAAGAACTGAGG + Intergenic
1060357045 9:122918940-122918962 CCTTTCCAGTGTAAAATCTGTGG - Exonic
1060767745 9:126307743-126307765 CGGCTCCAGTGTGAGCTCTGTGG + Intergenic
1060851532 9:126880690-126880712 CCATTCCGCTGTGAGATCTGCGG + Exonic
1062622990 9:137430971-137430993 CCATCCCTGTGTAAGACCTGGGG + Intronic
1190362970 X:49666571-49666593 CCTTTTAAGTGTAAGATCTGTGG - Intergenic
1194926141 X:99826599-99826621 CAGTTCCAATGGAAGAACTGTGG + Intergenic
1194946843 X:100079025-100079047 CCTTTCAAATGTAAAATCTGTGG + Intergenic