ID: 1174609934

View in Genome Browser
Species Human (GRCh38)
Location 20:51790700-51790722
Sequence GGAACGGTCTCTCCCCGGTG TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 90
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 79}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1174609929_1174609934 14 Left 1174609929 20:51790663-51790685 CCTTTGGTAGAAAAGGCTCGGCC 0: 1
1: 0
2: 3
3: 7
4: 64
Right 1174609934 20:51790700-51790722 GGAACGGTCTCTCCCCGGTGTGG 0: 1
1: 0
2: 0
3: 10
4: 79
1174609931_1174609934 -7 Left 1174609931 20:51790684-51790706 CCACAGATCTTACACTGGAACGG 0: 1
1: 0
2: 3
3: 9
4: 71
Right 1174609934 20:51790700-51790722 GGAACGGTCTCTCCCCGGTGTGG 0: 1
1: 0
2: 0
3: 10
4: 79

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1174609934 Original CRISPR GGAACGGTCTCTCCCCGGTG TGG Exonic
901081882 1:6588303-6588325 TGAAGGGCCTTTCCCCGGTGTGG - Exonic
919916933 1:202144641-202144663 GGAGCGGCCCCTCCCCGGTACGG + Exonic
1064340769 10:14483462-14483484 GGAACGGTCCCTCTCAGGAGGGG + Intergenic
1067300501 10:45003848-45003870 GGTAGGGTTTCTCCCCAGTGTGG - Exonic
1072249738 10:93572217-93572239 GGAAAGGTCTCTGCTGGGTGTGG + Intronic
1081911922 11:46705251-46705273 GGTAAGGACGCTCCCCGGTGTGG - Exonic
1089349822 11:117815996-117816018 GGGAGGGTCTCCCCCAGGTGTGG - Intronic
1091474028 12:753920-753942 GTCACGGTCTCTTCCCGGTGGGG - Exonic
1096023674 12:48343089-48343111 GGAAGGGCTTCTCCCCAGTGTGG + Exonic
1096494864 12:52033969-52033991 GGAAGGGTGTCTCCTAGGTGGGG + Intronic
1098974576 12:76889174-76889196 AGAGGGGTCTCTCCCAGGTGTGG + Intergenic
1103968647 12:124655847-124655869 GGGAAGCTCTCTCCCCGGGGTGG + Intergenic
1108460025 13:50656539-50656561 GGAACTCTCTCCCCCAGGTGGGG + Intronic
1114364607 14:22013079-22013101 CGAAGGGTCTCTCTCCAGTGTGG - Intergenic
1117896717 14:60495137-60495159 GGAACAGTCTCTCCCGAGTGTGG + Intronic
1121444022 14:93967307-93967329 GGAAGGGGCTCTGCCCAGTGAGG + Intronic
1125163143 15:36671181-36671203 AGAACGGCCTCTTCCCTGTGTGG - Intronic
1132942137 16:2513705-2513727 GGACCGGTCTCGCGCCGGGGCGG - Intronic
1136564579 16:31062255-31062277 GGAAGGGGCGCTCGCCGGTGTGG + Exonic
1136927467 16:34388464-34388486 TGAACGGCTTCTCCCCAGTGTGG + Intergenic
1136977107 16:35023342-35023364 TGAACGGCTTCTCCCCAGTGTGG - Exonic
1140047146 16:71448260-71448282 TGAAGGGTTTCTCCCCAGTGTGG + Exonic
1143449405 17:7026979-7027001 GGTAGGGCTTCTCCCCGGTGTGG - Exonic
1143583821 17:7841761-7841783 GGCACCGTCACTCCTCGGTGGGG + Intronic
1150820441 17:68430254-68430276 GGCACAGTCTCTCCCTGCTGCGG - Intronic
1160507755 18:79436896-79436918 GGGGTGGTCTCTCCCCGGCGTGG - Intronic
1160878781 19:1310288-1310310 GGAACGGCCTCTCGCAGGTGAGG + Intergenic
1162219133 19:9161214-9161236 CGTACGGTTTCTCCCCCGTGTGG - Exonic
1162457568 19:10795280-10795302 GGAACGTTCTCTCCCACGTGTGG - Intronic
1166602217 19:44106835-44106857 TGAACGGTTTCTCTCCAGTGTGG - Exonic
1168111032 19:54191384-54191406 CGAACGGCCGCTCCCTGGTGTGG + Exonic
1168340792 19:55621966-55621988 GGAACGGGCGCTCGCCAGTGTGG + Exonic
1168419169 19:56189997-56190019 TAAACGGCCTCTCCCCGGTGTGG + Exonic
1168580008 19:57547466-57547488 TGTATGGTTTCTCCCCGGTGTGG + Exonic
1168722625 19:58562569-58562591 CGAAGGGCCGCTCCCCGGTGTGG + Exonic
944928514 2:204491455-204491477 GGAAAGGTATCTGCCCAGTGGGG - Intergenic
1171218297 20:23369660-23369682 TGAATGGCCTCTCCCCTGTGTGG - Exonic
1171293189 20:23994250-23994272 AGAACAGCCTCTCCCCAGTGGGG + Intergenic
1172289008 20:33761862-33761884 GGAAGGGCTTCTCACCGGTGTGG - Exonic
1174609934 20:51790700-51790722 GGAACGGTCTCTCCCCGGTGTGG + Exonic
1174610045 20:51791252-51791274 CGAAGGGTCTCTCTCCAGTGTGG + Exonic
1175465961 20:59191514-59191536 GGAAGGGCCTCTCACCCGTGTGG - Exonic
1176178528 20:63739500-63739522 GGAACGGGCCCTCCCCGGCGGGG + Intronic
1180094572 21:45550015-45550037 GGAACTGTCTCTCCCCGGCCAGG + Intergenic
1180235980 21:46459417-46459439 GGAACGGTGTCTCCGGGGCGAGG - Intronic
1180618371 22:17143610-17143632 GGACAGGTCACTCCCCTGTGTGG + Intronic
1180824248 22:18851964-18851986 AGAACAGCCTCTCCCCAGTGGGG + Intronic
1181124676 22:20695118-20695140 AGAACAGCCTCTCCCCAGTGGGG + Intergenic
1181188488 22:21122584-21122606 AGAACAGCCTCTCCCCAGTGGGG - Intergenic
1181210712 22:21287909-21287931 AGAACAGCCTCTCCCCAGTGGGG + Intergenic
1181398798 22:22638979-22639001 AGAACAGCCTCTCCCCAGTGGGG - Intergenic
1181501529 22:23318335-23318357 AGAACAGCCTCTCCCCAGTGGGG - Intergenic
1181650624 22:24257080-24257102 AGAACAGCCTCTCCCCAGTGGGG + Intergenic
1181706757 22:24653658-24653680 AGAACAGCCTCTCCCCAGTGGGG - Intergenic
1185316398 22:50181028-50181050 GGAAGGGTCTATCCAGGGTGTGG + Intergenic
1203216235 22_KI270731v1_random:7521-7543 AGAACAGCCTCTCCCCAGTGGGG - Intergenic
1203274385 22_KI270734v1_random:77868-77890 AGAACAGCCTCTCCCCAGTGGGG + Intergenic
955769028 3:62371604-62371626 CGAACGGTCTGGCTCCGGTGTGG + Exonic
961064493 3:123863050-123863072 GGATCTGTCTCTGCCAGGTGTGG + Intronic
968900139 4:3427087-3427109 GGAAGGGTCTCTGCTCTGTGAGG - Intronic
969228182 4:5812497-5812519 GGAACGGCCTCTCCTGGCTGTGG - Exonic
969228208 4:5812613-5812635 GGAACGGCCTCTCCTGGCTGTGG - Exonic
979443731 4:120785067-120785089 GGAACGGTCTCTCCTCAGAGTGG + Exonic
981531828 4:145761351-145761373 GGAAGGGCCGCTCCCCGGTGTGG + Exonic
989527243 5:42467717-42467739 CAAAAGGTTTCTCCCCGGTGTGG + Intronic
990607315 5:57423600-57423622 CGAAGGGTCTCTCTCCAGTGTGG - Intergenic
992951016 5:81857846-81857868 GCCAAGGTTTCTCCCCGGTGGGG - Intergenic
995551649 5:113287679-113287701 GGAAGGCTTTCTCCCAGGTGGGG - Intronic
1002929283 6:1622283-1622305 GGAATAGTCTCTCCTGGGTGTGG + Intergenic
1007396502 6:41580986-41581008 TGATAGGTCTCTCCCTGGTGGGG - Intronic
1019557859 7:1641508-1641530 GGAATGGCCTCTCCCAGGAGAGG - Intergenic
1034176460 7:149103872-149103894 GGAAGGGCTTCTCCCCGCTGTGG + Exonic
1034186262 7:149179552-149179574 GGTAGGGCCGCTCCCCGGTGTGG - Exonic
1034262520 7:149765685-149765707 GGAAGGGCCGCTCGCCGGTGTGG + Exonic
1034347574 7:150396865-150396887 GGTACGGCTTCTCCCCGGTGTGG - Exonic
1034499567 7:151440760-151440782 GGAACTCTCCCTCCGCGGTGGGG - Intronic
1034732482 7:153400045-153400067 GGGACACTCTCTCCCCCGTGAGG + Intergenic
1049558612 8:143296365-143296387 CGTACAGCCTCTCCCCGGTGTGG - Exonic
1049558687 8:143296701-143296723 GGAACGGCTTCTCGCCCGTGTGG - Exonic
1049846987 8:144807594-144807616 GGAACGGCTTCTCCTCAGTGTGG - Exonic
1049847020 8:144807762-144807784 CGAAGGGCTTCTCCCCGGTGTGG - Exonic
1050069045 9:1791373-1791395 GAAACTGTCTCTCACCAGTGTGG - Intergenic
1051278935 9:15422566-15422588 GCAACTGTCTCTGCCCGGTAGGG - Intergenic
1055476364 9:76667181-76667203 GCAACGGTCACTCTCTGGTGTGG + Intronic
1057640757 9:96818672-96818694 CGAATGGTTTCTCCCCTGTGTGG + Exonic
1187946890 X:24434719-24434741 GGAACCCTCCTTCCCCGGTGAGG + Intergenic
1197739057 X:129875330-129875352 GGATGGGTCTCTCCCCAATGTGG - Intergenic
1199608599 X:149595350-149595372 AGAAGGGTCTCTGCCTGGTGGGG - Intergenic
1199630523 X:149774010-149774032 AGAAGGGTCTCTGCCTGGTGGGG + Intergenic
1200964087 Y:9020676-9020698 GGATGGTTCTCTCCCAGGTGGGG - Intergenic