ID: 1174609935

View in Genome Browser
Species Human (GRCh38)
Location 20:51790701-51790723
Sequence GAACGGTCTCTCCCCGGTGT GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 74
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 61}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1174609929_1174609935 15 Left 1174609929 20:51790663-51790685 CCTTTGGTAGAAAAGGCTCGGCC 0: 1
1: 0
2: 3
3: 7
4: 64
Right 1174609935 20:51790701-51790723 GAACGGTCTCTCCCCGGTGTGGG 0: 1
1: 0
2: 0
3: 12
4: 61
1174609931_1174609935 -6 Left 1174609931 20:51790684-51790706 CCACAGATCTTACACTGGAACGG 0: 1
1: 0
2: 3
3: 9
4: 71
Right 1174609935 20:51790701-51790723 GAACGGTCTCTCCCCGGTGTGGG 0: 1
1: 0
2: 0
3: 12
4: 61

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1174609935 Original CRISPR GAACGGTCTCTCCCCGGTGT GGG Exonic
901081881 1:6588302-6588324 GAAGGGCCTTTCCCCGGTGTGGG - Exonic
906082752 1:43104395-43104417 GTAAGGTCTCTCCCCAGTATGGG - Intergenic
922751778 1:228073465-228073487 GAAAGGGGTCTCCCGGGTGTAGG + Intergenic
1063274666 10:4552485-4552507 TAACGATCTCTCTCCGGTGAAGG - Intergenic
1067300500 10:45003847-45003869 GTAGGGTTTCTCCCCAGTGTGGG - Exonic
1068954853 10:62813444-62813466 GAAGGGCTTCTCACCGGTGTGGG + Exonic
1072249739 10:93572218-93572240 GAAAGGTCTCTGCTGGGTGTGGG + Intronic
1072463909 10:95645798-95645820 GCACGGTCTCTTCCTGCTGTGGG + Intronic
1074968143 10:118511577-118511599 CTAATGTCTCTCCCCGGTGTGGG - Intergenic
1088685384 11:112280576-112280598 GAACGGGCTCTCCTCCGCGTTGG - Intergenic
1096023675 12:48343090-48343112 GAAGGGCTTCTCCCCAGTGTGGG + Exonic
1100142726 12:91638145-91638167 GAATGGTCTGTCCCAGGTGCAGG - Intergenic
1103412398 12:120721708-120721730 GAATGGTCTCTCCCCTCTCTCGG - Exonic
1114364606 14:22013078-22013100 GAAGGGTCTCTCTCCAGTGTGGG - Intergenic
1117896718 14:60495138-60495160 GAACAGTCTCTCCCGAGTGTGGG + Intronic
1129190141 15:73932550-73932572 GCAGAGTCTCTCCCCAGTGTGGG + Intronic
1129942413 15:79509955-79509977 GAACTTTCTCTCCCCTGAGTGGG + Intergenic
1131123449 15:89837877-89837899 GAGGGGTCTCTCCCAGGTCTTGG + Intronic
1131136080 15:89936730-89936752 GTAGGGCCTCTCCCCAGTGTGGG - Intergenic
1131196620 15:90360514-90360536 ATAGGGTCTCTCCCCTGTGTGGG - Exonic
1132950723 16:2560799-2560821 GGAGGGTCTCTCCCCTGTTTGGG + Intronic
1132963627 16:2639371-2639393 GGAGGGTCTCTCCCCTGTTTGGG - Intergenic
1136458830 16:30397648-30397670 GTAGGGTTTCTCCCCTGTGTGGG - Exonic
1136564580 16:31062256-31062278 GAAGGGGCGCTCGCCGGTGTGGG + Exonic
1136927468 16:34388465-34388487 GAACGGCTTCTCCCCAGTGTGGG + Intergenic
1136977106 16:35023341-35023363 GAACGGCTTCTCCCCAGTGTGGG - Exonic
1137786383 16:51140791-51140813 GAATGGCCTCTCTCCGGTATGGG + Exonic
1139542449 16:67628398-67628420 GTAAGGCTTCTCCCCGGTGTGGG - Exonic
1139754469 16:69132056-69132078 GAAGGGGCTCTTCCCGGGGTTGG - Intronic
1142296696 16:89228201-89228223 GTAGGGTTTCTCACCGGTGTGGG - Exonic
1150624889 17:66835308-66835330 GGACGGTCTCCCACCGGTGCTGG + Intronic
1158541060 18:58355022-58355044 AAAGGGTATCTGCCCGGTGTGGG + Intronic
1160507754 18:79436895-79436917 GGGTGGTCTCTCCCCGGCGTGGG - Intronic
1160878782 19:1310289-1310311 GAACGGCCTCTCGCAGGTGAGGG + Intergenic
1161187775 19:2933735-2933757 GTACGGTTTCTCTCCGCTGTGGG + Exonic
1166812207 19:45521368-45521390 GAACGGCCCCTCCCCGGAGGAGG + Exonic
1167536935 19:50059715-50059737 GTAGGGTTTCTCCCCCGTGTGGG + Intergenic
1168111033 19:54191385-54191407 GAACGGCCGCTCCCTGGTGTGGG + Exonic
1168703636 19:58455777-58455799 GTAGGGCCGCTCCCCGGTGTGGG - Exonic
1168706144 19:58471325-58471347 GTAGGGCCGCTCCCCGGTGTGGG - Exonic
926982626 2:18587241-18587263 GACCAGTCTCCCCCCTGTGTAGG + Intronic
948126218 2:235566663-235566685 GAACAGCCTCTCCCCGGTCCCGG - Intronic
1172661695 20:36573331-36573353 GAGCGGGCTCTCCCCGGCGGAGG + Intergenic
1174609935 20:51790701-51790723 GAACGGTCTCTCCCCGGTGTGGG + Exonic
1174610046 20:51791253-51791275 GAAGGGTCTCTCTCCAGTGTGGG + Exonic
1175235624 20:57508738-57508760 GAATGGTTTCTCTCCAGTGTGGG + Exonic
1175465960 20:59191513-59191535 GAAGGGCCTCTCACCCGTGTGGG - Exonic
1180618372 22:17143611-17143633 GACAGGTCACTCCCCTGTGTGGG + Intronic
954211530 3:49100218-49100240 GGACGGTCTCTCCAGGGTGAAGG + Exonic
962390931 3:134972110-134972132 GAATTGCCTCTCCCCTGTGTGGG + Intronic
974876629 4:67710616-67710638 AAATGGCCTCTCCCTGGTGTCGG + Intergenic
976244079 4:82990069-82990091 GAATGGTCTCACCCAGGTGGTGG - Intronic
979443732 4:120785068-120785090 GAACGGTCTCTCCTCAGAGTGGG + Exonic
981545178 4:145886125-145886147 GAAAGGTCTCTCCCCGATCCTGG + Exonic
986412413 5:7493938-7493960 TAACGCTCTCTCCCCGGTCCCGG + Intronic
990448374 5:55913961-55913983 GAGCAGTGTCTCCACGGTGTTGG + Intronic
990607314 5:57423599-57423621 GAAGGGTCTCTCTCCAGTGTGGG - Intergenic
992091109 5:73317716-73317738 GAACACTCACTCCCCGGTGGAGG + Intergenic
1002929284 6:1622284-1622306 GAATAGTCTCTCCTGGGTGTGGG + Intergenic
1014375796 6:120671307-120671329 GAACGTTCTCATCCCTGTGTAGG - Intergenic
1018195087 6:161348484-161348506 GCCCAGTCTCTCCCCGGTGCAGG + Exonic
1024110873 7:46145269-46145291 AAAGGGTTTCTCCCCAGTGTGGG - Intergenic
1026741085 7:72979014-72979036 AAACGGCCTTTCCCTGGTGTTGG - Intergenic
1031483232 7:122302309-122302331 GAACTGCTTCTCCCCGCTGTGGG + Exonic
1034262521 7:149765686-149765708 GAAGGGCCGCTCGCCGGTGTGGG + Exonic
1034347573 7:150396864-150396886 GTACGGCTTCTCCCCGGTGTGGG - Exonic
1049558611 8:143296364-143296386 GTACAGCCTCTCCCCGGTGTGGG - Exonic
1050069044 9:1791372-1791394 AAACTGTCTCTCACCAGTGTGGG - Intergenic
1057640758 9:96818673-96818695 GAATGGTTTCTCCCCTGTGTGGG + Exonic
1194398811 X:93418767-93418789 AAATGGTCTCTCCCTGGTGCTGG + Intergenic
1197739056 X:129875329-129875351 GATGGGTCTCTCCCCAATGTGGG - Intergenic
1199608598 X:149595349-149595371 GAAGGGTCTCTGCCTGGTGGGGG - Intergenic
1199630524 X:149774011-149774033 GAAGGGTCTCTGCCTGGTGGGGG + Intergenic
1200378228 X:155806757-155806779 GAACGGTTTCTACCCAGTGATGG - Intergenic