ID: 1174609939

View in Genome Browser
Species Human (GRCh38)
Location 20:51790721-51790743
Sequence GGGTGCGATAATGCATCTTG AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 49
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 44}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1174609931_1174609939 14 Left 1174609931 20:51790684-51790706 CCACAGATCTTACACTGGAACGG 0: 1
1: 0
2: 3
3: 9
4: 71
Right 1174609939 20:51790721-51790743 GGGTGCGATAATGCATCTTGAGG 0: 1
1: 0
2: 0
3: 4
4: 44

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1174609939 Original CRISPR GGGTGCGATAATGCATCTTG AGG Exonic
902153404 1:14463105-14463127 GGGTGGGTTAATGCAAATTGAGG + Intergenic
902260117 1:15218834-15218856 GGGTGGGTTAATGCAAATTGAGG - Intronic
905764939 1:40592499-40592521 GGGTGGGTTAATGCAAATTGAGG - Intergenic
910454865 1:87386750-87386772 GGGTGCAAGGATGCATGTTGAGG - Intergenic
913595326 1:120370447-120370469 GGGTGCTATTATTCACCTTGTGG - Intergenic
914306589 1:146425338-146425360 GGGTGCTATTATTCACCTTGTGG - Intergenic
1070122123 10:73588030-73588052 GGGAGAGATAATGCATATAGAGG - Intronic
1073650815 10:105356047-105356069 GGGTTCAGTGATGCATCTTGCGG + Intergenic
1074608893 10:115002374-115002396 GGTTGCCATAGTGCCTCTTGAGG + Intergenic
1090519947 11:127467773-127467795 GGGTGCGATAAGGCTTCTTAGGG + Intergenic
1105796262 13:23856509-23856531 GGGTGGGTTAATGCAAATTGGGG + Intronic
1110784837 13:79511577-79511599 GTGTGTGATACTGAATCTTGAGG + Intronic
1117896722 14:60495158-60495180 GGGCACGGTAATGCATTTTGAGG + Intronic
1135992964 16:27228781-27228803 GGGTGCCATGATGGATCTGGAGG - Intronic
1135992984 16:27228837-27228859 GGGTACCATGATGCATCTGGAGG - Intronic
1137465061 16:48700277-48700299 GGGTCTGAAAGTGCATCTTGAGG + Intergenic
1142158017 16:88541555-88541577 GGGTGGGTTAATGCAAATTGAGG + Intergenic
1148962618 17:51406101-51406123 GGATGTGATAATACATCATGGGG + Intergenic
1150883335 17:69056960-69056982 TGGTGTGAAAATGCATTTTGGGG + Intronic
1159289639 18:66399169-66399191 TGATGCTATAATTCATCTTGAGG + Intergenic
1159923168 18:74244726-74244748 GGGTGTGAAATGGCATCTTGTGG + Intergenic
1160476151 18:79190114-79190136 GGGTTTGATACTGCATCTTCAGG + Intronic
925604013 2:5639807-5639829 GGGTGCTATTATTCACCTTGTGG - Intergenic
930748870 2:54913116-54913138 GGGTGTGAGACAGCATCTTGTGG + Intronic
937003611 2:118490846-118490868 GGGTGCCATACTGCCTGTTGCGG - Intergenic
943111481 2:183611401-183611423 GGGTGAGAAAGTGCATCTAGGGG + Intergenic
1174609939 20:51790721-51790743 GGGTGCGATAATGCATCTTGAGG + Exonic
1178026796 21:28477635-28477657 GGGTGAGGTAATGCAAATTGAGG - Intergenic
1179060876 21:37978158-37978180 GGGTGTGAAATTGCATCTTGTGG - Intronic
962495976 3:135938997-135939019 GGGTGAGATAATATGTCTTGTGG + Intergenic
962755851 3:138465003-138465025 GGGTGCTAAAAGGCAGCTTGGGG + Intronic
966480824 3:180406541-180406563 GGGTGCTACAATGAAGCTTGAGG - Intergenic
969185386 4:5470601-5470623 GGGTCGGCTGATGCATCTTGGGG - Intronic
979179241 4:117704789-117704811 AGGTGAGATAATGCCTCATGTGG - Intergenic
990607404 5:57424067-57424089 GGATGCAGTAATGCATCTTGAGG - Intergenic
999171649 5:149600434-149600456 GGGCCAGAGAATGCATCTTGAGG + Intronic
1000382606 5:160642531-160642553 GGGGGTGCTAATGCATCTTGTGG + Intronic
1003043808 6:2714336-2714358 GGGTGAGTTAATGCAAATTGAGG - Intronic
1004615402 6:17283124-17283146 GTGTGCAAAAATGGATCTTGGGG + Intronic
1010675913 6:78742752-78742774 GGGTGGGTTAATGCAAATTGAGG - Intergenic
1016086219 6:139918632-139918654 GGGTGCGTGCATGCATGTTGGGG - Intergenic
1024747671 7:52427161-52427183 GGGTGGGTTAATGCAAATTGAGG - Intergenic
1036911963 8:12765209-12765231 GGGTGCGTTTATGCAGTTTGTGG + Intergenic
1040604656 8:48919980-48920002 GGGTCCGAATATGCATCTTCAGG + Exonic
1051801863 9:20943845-20943867 TGGTAAGATAATGCAGCTTGTGG - Intronic
1052476893 9:28971576-28971598 GAGTGGGAGACTGCATCTTGTGG + Intergenic
1188762948 X:34054478-34054500 GGTTGTGATAAGGGATCTTGTGG + Intergenic
1190993863 X:55585068-55585090 GGTTTCGATAATGAATTTTGGGG - Intergenic
1195373931 X:104207065-104207087 GGGTGGGTTAATGCAAATTGAGG + Intergenic