ID: 1174609940

View in Genome Browser
Species Human (GRCh38)
Location 20:51790722-51790744
Sequence GGTGCGATAATGCATCTTGA GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 59
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 55}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1174609931_1174609940 15 Left 1174609931 20:51790684-51790706 CCACAGATCTTACACTGGAACGG 0: 1
1: 0
2: 3
3: 9
4: 71
Right 1174609940 20:51790722-51790744 GGTGCGATAATGCATCTTGAGGG 0: 1
1: 0
2: 0
3: 3
4: 55

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1174609940 Original CRISPR GGTGCGATAATGCATCTTGA GGG Exonic
902260116 1:15218833-15218855 GGTGGGTTAATGCAAATTGAGGG - Intronic
903656551 1:24952311-24952333 GGTGAGATGATGCATCTGGAAGG - Intronic
905350479 1:37342860-37342882 GGTGTGGTTATGCATTTTGAAGG - Intergenic
905764938 1:40592498-40592520 GGTGGGTTAATGCAAATTGAGGG - Intergenic
1063519375 10:6727024-6727046 GGTGGGATAATTGTTCTTGATGG + Intergenic
1064466823 10:15591739-15591761 GGTGAGATACTCCATTTTGAGGG - Intronic
1077547321 11:3180007-3180029 AGTGCGATAATGCACTTTCATGG + Intergenic
1080421077 11:32110951-32110973 GGTGAGATAATGCATGTGCAAGG + Intergenic
1083909886 11:65700480-65700502 GGTGAGTTAATGCAAATTGATGG + Intergenic
1089625461 11:119748273-119748295 GGTGCTTTAGTGCAACTTGAAGG + Intergenic
1106741594 13:32648944-32648966 GGGGCTATAATGTATCTTGTTGG + Intronic
1112131380 13:96527595-96527617 GGTCAGATAAAGCATCTTGGAGG + Intronic
1113483763 13:110640144-110640166 GCTGCAATAAAGCACCTTGAAGG + Intergenic
1116482211 14:45405034-45405056 GGTGCAATAATTCATGTGGAAGG + Intergenic
1117896723 14:60495159-60495181 GGCACGGTAATGCATTTTGAGGG + Intronic
1118571718 14:67200915-67200937 GGTGGGGTTGTGCATCTTGAAGG - Intronic
1123692525 15:22850450-22850472 GGAACGATAATGCACCTTAATGG + Intronic
1127524541 15:59779332-59779354 GGTGCATTAGTGCTTCTTGATGG + Intergenic
1128323007 15:66705734-66705756 GGTGGGATTATGTTTCTTGAGGG - Intronic
1131809345 15:96156485-96156507 TATGAGATAATGCACCTTGAAGG - Intergenic
1131904861 15:97132268-97132290 TGTGCGATAATGAATTTTGGTGG - Intergenic
1135992963 16:27228780-27228802 GGTGCCATGATGGATCTGGAGGG - Intronic
1135992983 16:27228836-27228858 GGTACCATGATGCATCTGGAGGG - Intronic
1138218523 16:55227273-55227295 TGTGAGATAATGCTGCTTGAGGG + Intergenic
1152508406 17:80769022-80769044 GAATCGATAATGCCTCTTGATGG + Intronic
1155537861 18:26835859-26835881 GCTGTGATAATGCATCTTTGTGG - Intergenic
1159289640 18:66399170-66399192 GATGCTATAATTCATCTTGAGGG + Intergenic
926356258 2:12043419-12043441 GGAAAGATGATGCATCTTGATGG + Intergenic
929661448 2:43789466-43789488 GGTGCTTTGATGCATTTTGAGGG + Intronic
930542646 2:52726322-52726344 GGAGCCATACTGCTTCTTGAGGG - Intergenic
932407299 2:71522013-71522035 GGTGGGATAATGCAGCGGGAGGG - Intronic
942112245 2:172693905-172693927 GGTCTGAAAATGGATCTTGAGGG - Intergenic
1173928990 20:46802840-46802862 GATGGGATAATGCCTCATGATGG + Intergenic
1174609940 20:51790722-51790744 GGTGCGATAATGCATCTTGAGGG + Exonic
1178026795 21:28477634-28477656 GGTGAGGTAATGCAAATTGAGGG - Intergenic
965924668 3:173963101-173963123 GATGAGATAATGCATTTTAAAGG - Intronic
966028421 3:175315108-175315130 GGAGCTATAATGTAGCTTGATGG + Intronic
967511047 3:190312871-190312893 GGTGCGATATTTCTTCTTGCAGG - Exonic
971786290 4:31107237-31107259 GGTGAAATAATGCAAATTGAAGG + Intronic
984009164 4:174349627-174349649 GGAGCAAGAATGGATCTTGAAGG - Intergenic
990607403 5:57424066-57424088 GATGCAGTAATGCATCTTGAGGG - Intergenic
1000126762 5:158253041-158253063 GGTGTGATAAAGCAGCATGATGG + Intergenic
1000382607 5:160642532-160642554 GGGGTGCTAATGCATCTTGTGGG + Intronic
1003043807 6:2714335-2714357 GGTGAGTTAATGCAAATTGAGGG - Intronic
1003050649 6:2778009-2778031 GGTGAGATGAGGCATCTTTAAGG + Intronic
1007951495 6:45876556-45876578 TGTGAGATAATGCATCAAGAAGG + Intergenic
1010675912 6:78742751-78742773 GGTGGGTTAATGCAAATTGAGGG - Intergenic
1024747670 7:52427160-52427182 GGTGGGTTAATGCAAATTGAGGG - Intergenic
1028067096 7:86400165-86400187 GTTGTGATAATGCATTTTTATGG + Intergenic
1040604657 8:48919981-48920003 GGTCCGAATATGCATCTTCAGGG + Exonic
1040750540 8:50700695-50700717 GGAACGATAAATCATCTTGAGGG - Intronic
1047425376 8:124740683-124740705 GGTCCAGTAATGCATCTAGATGG - Intergenic
1051759594 9:20447228-20447250 AGTGATATAAGGCATCTTGATGG + Intronic
1186687762 X:11943471-11943493 CATGGGATAATGCAGCTTGAAGG - Intergenic
1190998999 X:55639145-55639167 GGTGGGTTAATGCAAATTGAAGG + Intergenic
1194339621 X:92692718-92692740 GCTGCGAAAATGAATCCTGAAGG - Intergenic
1195373932 X:104207066-104207088 GGTGGGTTAATGCAAATTGAGGG + Intergenic
1196134266 X:112190053-112190075 AATGCGATAATGCATCTTTGTGG + Intergenic
1200648005 Y:5809498-5809520 GCTGCGAAAATGAATCCTGAAGG - Intergenic