ID: 1174612301

View in Genome Browser
Species Human (GRCh38)
Location 20:51808174-51808196
Sequence TAACCACAGCTGCTTCAATT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1174612298_1174612301 19 Left 1174612298 20:51808132-51808154 CCTCTGTTTATTCATGCCAGGAA No data
Right 1174612301 20:51808174-51808196 TAACCACAGCTGCTTCAATTTGG No data
1174612294_1174612301 29 Left 1174612294 20:51808122-51808144 CCCCTTTGGACCTCTGTTTATTC No data
Right 1174612301 20:51808174-51808196 TAACCACAGCTGCTTCAATTTGG No data
1174612296_1174612301 27 Left 1174612296 20:51808124-51808146 CCTTTGGACCTCTGTTTATTCAT No data
Right 1174612301 20:51808174-51808196 TAACCACAGCTGCTTCAATTTGG No data
1174612299_1174612301 3 Left 1174612299 20:51808148-51808170 CCAGGAAGCAAAGTCGACTGACT No data
Right 1174612301 20:51808174-51808196 TAACCACAGCTGCTTCAATTTGG No data
1174612295_1174612301 28 Left 1174612295 20:51808123-51808145 CCCTTTGGACCTCTGTTTATTCA No data
Right 1174612301 20:51808174-51808196 TAACCACAGCTGCTTCAATTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1174612301 Original CRISPR TAACCACAGCTGCTTCAATT TGG Intergenic
No off target data available for this crispr