ID: 1174614750

View in Genome Browser
Species Human (GRCh38)
Location 20:51827236-51827258
Sequence TGGATGGGCGCTTCCATTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1174614743_1174614750 4 Left 1174614743 20:51827209-51827231 CCGATCACAGACACTGTGGCCCC No data
Right 1174614750 20:51827236-51827258 TGGATGGGCGCTTCCATTGCTGG No data
1174614742_1174614750 5 Left 1174614742 20:51827208-51827230 CCCGATCACAGACACTGTGGCCC No data
Right 1174614750 20:51827236-51827258 TGGATGGGCGCTTCCATTGCTGG No data
1174614741_1174614750 6 Left 1174614741 20:51827207-51827229 CCCCGATCACAGACACTGTGGCC No data
Right 1174614750 20:51827236-51827258 TGGATGGGCGCTTCCATTGCTGG No data
1174614737_1174614750 24 Left 1174614737 20:51827189-51827211 CCGGCAGCCAGGGAGCACCCCCG No data
Right 1174614750 20:51827236-51827258 TGGATGGGCGCTTCCATTGCTGG No data
1174614740_1174614750 7 Left 1174614740 20:51827206-51827228 CCCCCGATCACAGACACTGTGGC No data
Right 1174614750 20:51827236-51827258 TGGATGGGCGCTTCCATTGCTGG No data
1174614738_1174614750 17 Left 1174614738 20:51827196-51827218 CCAGGGAGCACCCCCGATCACAG No data
Right 1174614750 20:51827236-51827258 TGGATGGGCGCTTCCATTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1174614750 Original CRISPR TGGATGGGCGCTTCCATTGC TGG Intergenic
No off target data available for this crispr