ID: 1174614771

View in Genome Browser
Species Human (GRCh38)
Location 20:51827351-51827373
Sequence TGGACGGGCGCTTCCGTCGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1174614762_1174614771 6 Left 1174614762 20:51827322-51827344 CCCCGATCACGGACACTGTGGCC No data
Right 1174614771 20:51827351-51827373 TGGACGGGCGCTTCCGTCGCTGG No data
1174614758_1174614771 17 Left 1174614758 20:51827311-51827333 CCAGGGAGCACCCCCGATCACGG No data
Right 1174614771 20:51827351-51827373 TGGACGGGCGCTTCCGTCGCTGG No data
1174614764_1174614771 4 Left 1174614764 20:51827324-51827346 CCGATCACGGACACTGTGGCCCC No data
Right 1174614771 20:51827351-51827373 TGGACGGGCGCTTCCGTCGCTGG No data
1174614757_1174614771 24 Left 1174614757 20:51827304-51827326 CCGGCAGCCAGGGAGCACCCCCG No data
Right 1174614771 20:51827351-51827373 TGGACGGGCGCTTCCGTCGCTGG No data
1174614763_1174614771 5 Left 1174614763 20:51827323-51827345 CCCGATCACGGACACTGTGGCCC No data
Right 1174614771 20:51827351-51827373 TGGACGGGCGCTTCCGTCGCTGG No data
1174614761_1174614771 7 Left 1174614761 20:51827321-51827343 CCCCCGATCACGGACACTGTGGC No data
Right 1174614771 20:51827351-51827373 TGGACGGGCGCTTCCGTCGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1174614771 Original CRISPR TGGACGGGCGCTTCCGTCGC TGG Intergenic
No off target data available for this crispr