ID: 1174615655

View in Genome Browser
Species Human (GRCh38)
Location 20:51833387-51833409
Sequence CAAGGTAATCCTTAAGAGAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 144
Summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 137}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1174615649_1174615655 10 Left 1174615649 20:51833354-51833376 CCTTTATATCACGATGGCTTCCT 0: 1
1: 0
2: 0
3: 7
4: 77
Right 1174615655 20:51833387-51833409 CAAGGTAATCCTTAAGAGAGAGG 0: 1
1: 0
2: 1
3: 5
4: 137
1174615652_1174615655 -10 Left 1174615652 20:51833374-51833396 CCTGTCCCTATGGCAAGGTAATC 0: 1
1: 0
2: 0
3: 9
4: 56
Right 1174615655 20:51833387-51833409 CAAGGTAATCCTTAAGAGAGAGG 0: 1
1: 0
2: 1
3: 5
4: 137

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1174615655 Original CRISPR CAAGGTAATCCTTAAGAGAG AGG Intergenic
904201872 1:28825139-28825161 CAAGGCAATGGTTAAGAGTGTGG - Intronic
904579516 1:31530934-31530956 CAAGAAAAGCCTTCAGAGAGGGG - Intergenic
906926140 1:50118858-50118880 CAATGTAATCCTTAAAGTAGGGG + Intronic
907315132 1:53564297-53564319 ATAGGTAATCATTAAGAGAAAGG + Intronic
907819370 1:57952238-57952260 CATGCCAATCCTCAAGAGAGGGG - Intronic
908325650 1:63020914-63020936 CAAAGTAATTCTTACTAGAGTGG - Intergenic
909985460 1:82155798-82155820 AGAGGTAATCCTGAACAGAGTGG - Intergenic
913248800 1:116893953-116893975 CAGGGTAATCCCTGAGAGAAGGG + Intergenic
915536471 1:156539136-156539158 CAAGACATTCCTTAAGAGCGGGG - Intronic
918511426 1:185317477-185317499 CAAGGTGATCCTGAGGAGATAGG + Intergenic
922042423 1:221909632-221909654 CCAGGTAATGGTTAAGAAAGTGG + Intergenic
1063234029 10:4093671-4093693 CAAGGTCATCCTCAACACAGAGG - Intergenic
1063359425 10:5439237-5439259 AGGGGTAATCCTAAAGAGAGCGG - Intronic
1066313711 10:34222834-34222856 CTAGCAAATGCTTAAGAGAGCGG - Intronic
1066586922 10:36945711-36945733 CAAGGAAAGCCTTCAAAGAGAGG - Intergenic
1072034143 10:91549144-91549166 CAAGGCAGTCCATAATAGAGAGG + Intergenic
1072297976 10:94030135-94030157 CAATGCAATCCAGAAGAGAGTGG - Intronic
1074341969 10:112641082-112641104 CAAGGTGATCATTCTGAGAGGGG + Intronic
1075951690 10:126483621-126483643 TAAGGTAATCCTTAAAAAGGAGG + Intronic
1079200211 11:18370614-18370636 AAAGATAATCCTTAACAAAGGGG + Intergenic
1082722831 11:56699648-56699670 GAAGAGAATCCTGAAGAGAGTGG + Intergenic
1087895363 11:103580161-103580183 GAAGCTAATCCAGAAGAGAGGGG - Intergenic
1089949655 11:122513530-122513552 CATGCTAATCCTTCATAGAGTGG + Intergenic
1091792340 12:3279063-3279085 CAAGGTAAGCCTTACCAGATGGG + Exonic
1092898899 12:13040255-13040277 AAAGGCAATCCTAAGGAGAGCGG + Intergenic
1093788704 12:23221645-23221667 CCAGGTAGTCCTTAAAAGACTGG - Intergenic
1098930411 12:76405806-76405828 GATGGTCATCATTAAGAGAGTGG - Intronic
1099520582 12:83655897-83655919 CGAGGTCAGCCTTCAGAGAGAGG - Intergenic
1100117029 12:91319330-91319352 AGAGGAAATCCTTAAAAGAGAGG + Intergenic
1100560540 12:95744972-95744994 CAACGTAAGCCTGAAGACAGCGG - Intronic
1106613052 13:31301665-31301687 CAAGGTAACAATTAAGAGAGAGG - Intronic
1110790816 13:79584774-79584796 CATGGTAATGCATAGGAGAGGGG - Intergenic
1111126396 13:83914305-83914327 CAAGGTTATGTTTATGAGAGGGG + Intergenic
1111454867 13:88467281-88467303 CAAGGTAATAATTAGCAGAGTGG - Intergenic
1111882882 13:93980587-93980609 CAAGGCAATCTTTCAGAGAAAGG - Intronic
1115931234 14:38497757-38497779 GGAGGTAAAACTTAAGAGAGAGG - Intergenic
1119080306 14:71686746-71686768 TAAGGCAATCCTGAAGAGATGGG - Intronic
1119373623 14:74169355-74169377 GAAGGTAACTCTTAAGAGAAAGG - Intronic
1119403002 14:74377052-74377074 AAAGGTTTTCCTTAATAGAGAGG + Intergenic
1120525167 14:85568945-85568967 CAGGCAAATCCTTAAGAGAAGGG - Intronic
1122436390 14:101703883-101703905 CAAGGTGATCCTGAAGAAGGAGG + Intergenic
1124465261 15:29933230-29933252 CAAGCTAATGCTTAGGAAAGAGG + Intronic
1126368282 15:47918582-47918604 CAACTTAAGCCTAAAGAGAGAGG + Intergenic
1128006560 15:64247742-64247764 CAAGGTAATGATTAAGAGTTGGG + Intronic
1129959819 15:79674091-79674113 TAAGGTAATCCTTAAGAGAATGG + Intergenic
1130142390 15:81239260-81239282 CATGCTAATCCTAAACAGAGTGG - Intronic
1130706141 15:86234752-86234774 CAAGGTGATGTTTAAAAGAGTGG + Intronic
1131494100 15:92890007-92890029 CAAGTAAACCCTTAAGAGAAGGG - Intronic
1132118725 15:99158470-99158492 CTAGGAAAAGCTTAAGAGAGAGG + Intronic
1133339877 16:5029208-5029230 CATAGGAATCCTTAAGGGAGGGG + Intronic
1133896199 16:9931611-9931633 CAAGGTAATCCTTTGGTAAGAGG + Intronic
1134318258 16:13139535-13139557 ACAGGAAATCCTTAAGGGAGTGG - Intronic
1137873821 16:51976270-51976292 CAAGGAAATAATTAAGAGCGTGG + Intergenic
1139780549 16:69347978-69348000 CCAGGGAATCCTTAACAAAGGGG - Intronic
1141224683 16:82103909-82103931 CAGGGCAATGCTAAAGAGAGGGG - Intergenic
1143342400 17:6223303-6223325 CATGCTAATCCTAAACAGAGTGG + Intergenic
1145191975 17:20850751-20850773 CCAAGTTAACCTTAAGAGAGTGG - Intronic
1149857294 17:60093995-60094017 CACTGTACTCCTAAAGAGAGTGG + Intergenic
1155330320 18:24709321-24709343 CCAGGTAATTCTTTAGTGAGTGG + Intergenic
1155659511 18:28230879-28230901 CAAGGCAATTCCTCAGAGAGTGG - Intergenic
1157678566 18:49586031-49586053 CCACGTAATCCTTAAGGGTGTGG - Intronic
1158124574 18:54087035-54087057 AAAGGTAATCCACAAGGGAGGGG + Intergenic
1159535821 18:69713542-69713564 CAAGGTCACCTTTAACAGAGGGG - Intronic
1163546739 19:17945186-17945208 CAAGGTCATCCATAACAGTGGGG + Intergenic
1167162948 19:47779493-47779515 CCAGGAATCCCTTAAGAGAGGGG + Intronic
928488908 2:31760803-31760825 TAGGATAATCATTAAGAGAGTGG - Intergenic
930814910 2:55585798-55585820 CCAGGTAATCCTGGTGAGAGGGG + Intronic
931270112 2:60694050-60694072 CAAAGTAATGCTTAAGTAAGAGG - Intergenic
933301407 2:80545235-80545257 CATGGTAATTCTGAAGAGACTGG - Intronic
934855549 2:97727224-97727246 GAAGGGATTCCTTAAGGGAGAGG + Intronic
935833066 2:107020867-107020889 CAAGGTAATGGTTAAGACATAGG + Intergenic
935865718 2:107385516-107385538 CAAGGGTATCCGGAAGAGAGAGG - Intergenic
936591414 2:113808163-113808185 CAAGGTTATGGTTATGAGAGAGG + Intergenic
936604631 2:113937661-113937683 CAAGGTAAGCCAGAAGACAGTGG - Intronic
939680665 2:145128150-145128172 CAAGGGAATCCCTAAGAAAAAGG - Intergenic
939803584 2:146744486-146744508 CAAGGTAGTGGTTAAGAGAGGGG + Intergenic
942049141 2:172122389-172122411 AAAGGTTTTCATTAAGAGAGAGG + Intergenic
942559804 2:177208692-177208714 GAAGGTAACCCTTAAAAGGGAGG - Intergenic
942822376 2:180129866-180129888 AAAGGAAATCCTGAGGAGAGGGG + Intergenic
944071134 2:195670510-195670532 CATGGTTATACTTAAGAGAAAGG - Intronic
944141600 2:196462822-196462844 AAGGGAAAGCCTTAAGAGAGTGG + Intronic
947415858 2:229894933-229894955 CAAAGTAAACCTTTAGAGAAAGG + Intronic
948748541 2:240113260-240113282 CATAGTAAGCCTTGAGAGAGGGG + Intergenic
1169751361 20:8998012-8998034 CCAAGCAATCCTAAAGAGAGGGG - Intergenic
1174493901 20:50925089-50925111 CAAGGAACTCCTTAAGGCAGAGG + Intronic
1174615655 20:51833387-51833409 CAAGGTAATCCTTAAGAGAGAGG + Intergenic
1182849733 22:33462210-33462232 CAATGTAAGCCTTAAGGGAGTGG + Intronic
1182898547 22:33878721-33878743 GAATCTAATCCTTAAAAGAGAGG + Intronic
951040603 3:17984846-17984868 GAAGGCAATCCTAAAGAGAGAGG - Intronic
951057766 3:18167808-18167830 GAAGGTAATCTTCAAGTGAGAGG - Intronic
952533097 3:34282204-34282226 CAGGGTAATCCAGAACAGAGTGG - Intergenic
953476411 3:43209456-43209478 CAAGGAAATCCTAAGTAGAGTGG + Intergenic
958254451 3:91309102-91309124 CAAGGTAATCCTAAACAAAAAGG + Intergenic
961927359 3:130495313-130495335 CAAGGAAATCACTAAGAAAGTGG - Intergenic
965379595 3:167971884-167971906 CAAGTTAAGCAGTAAGAGAGAGG + Intergenic
965391152 3:168106004-168106026 AAAAGTAATCCTAAAGAGACAGG + Intergenic
966966330 3:184998229-184998251 CAGAGTAATCCTTAAGACATAGG - Intronic
970013502 4:11486530-11486552 CAAGGTAATTTTTAGCAGAGTGG - Intergenic
978969868 4:114790907-114790929 CAAAGAATTCATTAAGAGAGAGG - Intergenic
983902542 4:173151529-173151551 CGAGGCAATCCTAAAGACAGTGG - Intergenic
984161921 4:176263155-176263177 CATGGTAAGACTCAAGAGAGTGG - Intronic
984318328 4:178158245-178158267 CTATGTAAGCCTAAAGAGAGTGG + Intergenic
991004669 5:61815984-61816006 CTAGGTAATCCCTAAAAGAATGG + Intergenic
991772520 5:70052988-70053010 GAAGGTGATGGTTAAGAGAGTGG + Intronic
991851813 5:70928412-70928434 GAAGGTGATGGTTAAGAGAGTGG + Intronic
998355104 5:141528777-141528799 CAAGGTAATCTCTAGGAGATTGG + Exonic
1003784632 6:9471087-9471109 TAATGTGAACCTTAAGAGAGAGG + Intergenic
1008275628 6:49540623-49540645 CAAGTTTATCCTTAACAAAGAGG + Intergenic
1009825853 6:68865406-68865428 GAAGGTAACCCTGAAGAGAGAGG - Intronic
1012173540 6:96049534-96049556 CAAGGTAAACTATCAGAGAGAGG + Intronic
1012875244 6:104718880-104718902 CAAGTTATTCCATAAAAGAGGGG - Intergenic
1014140119 6:117931968-117931990 CAAGGTGATGATTAAGAGTGGGG + Intronic
1016492603 6:144623943-144623965 GAAAGTAATCATTGAGAGAGAGG + Intronic
1018731623 6:166656220-166656242 CAAGGAAATCATTGACAGAGGGG + Intronic
1021273199 7:18617541-18617563 CCAGGTAAAGCTTAACAGAGAGG - Intronic
1022211108 7:28210342-28210364 CTAAGTAATCCTTTAGAGAAAGG - Intergenic
1023285374 7:38613760-38613782 CAAAGTAAACCTTAGGACAGAGG + Intronic
1023325971 7:39057105-39057127 TAAGGAAAGACTTAAGAGAGAGG - Intronic
1024134514 7:46392735-46392757 AAAGGGAATGCTGAAGAGAGTGG - Intergenic
1035994510 8:4531023-4531045 CAACGTAATCCAACAGAGAGCGG - Intronic
1037189208 8:16101049-16101071 CAAGGTAAACCTAAAGCTAGCGG - Intergenic
1038105187 8:24425174-24425196 AAAGCTATGCCTTAAGAGAGAGG + Intergenic
1038535141 8:28348397-28348419 CAAGCTAATCCCCTAGAGAGTGG + Exonic
1039689332 8:39846913-39846935 CATAGTAATCCTTAAGAGGAAGG - Intergenic
1041332580 8:56743163-56743185 CTTGGCAATCCTTACGAGAGAGG - Intergenic
1042872513 8:73411430-73411452 CAAGTGACTCCTTCAGAGAGTGG - Intergenic
1043112516 8:76204526-76204548 CCTGGTAATTGTTAAGAGAGAGG + Intergenic
1043546123 8:81317646-81317668 CAAGTACATCCTTAAGAGAAGGG - Intergenic
1044161675 8:88925491-88925513 CAAGGCAAGCCAGAAGAGAGTGG + Intergenic
1048034097 8:130660638-130660660 GAAAATAATCCTTAAGAGATGGG - Intergenic
1049702573 8:144021829-144021851 CAAGGCAGTCCTGAGGAGAGAGG - Intronic
1049858784 8:144883035-144883057 CAAGGCAAGCTTTAAGAGAAAGG + Intronic
1050218138 9:3352726-3352748 GATGGTGATCCTTAAGAGAATGG + Intronic
1051867972 9:21703186-21703208 CAAGGTAATAGTTAAGAGTTTGG + Intergenic
1053493843 9:38533922-38533944 CAAGGGTATCCTTATTAGAGAGG + Intergenic
1056649581 9:88446743-88446765 CAACGTAAGCCTGAAGACAGTGG - Intronic
1057430182 9:94986923-94986945 AAAGGAAATCTTCAAGAGAGAGG - Intronic
1059919493 9:119142203-119142225 ATAGGTAATCCTAAAGTGAGAGG + Intergenic
1060467354 9:123918618-123918640 AAAGGTAATTTTTGAGAGAGGGG - Intronic
1186537405 X:10364264-10364286 CAACATCATCCTTCAGAGAGGGG - Intergenic
1195792990 X:108609777-108609799 CAAAGTAATCCAATAGAGAGGGG - Intronic
1197204789 X:123780444-123780466 AAAGGTGTTCCTTAAGTGAGAGG + Intergenic
1197663131 X:129195060-129195082 CAAGGTTAGGCTTATGAGAGAGG - Intergenic
1199940053 X:152616409-152616431 CAAGATACTCCTAAAGAAAGTGG - Intergenic