ID: 1174615715

View in Genome Browser
Species Human (GRCh38)
Location 20:51833935-51833957
Sequence GGATTTAAACTCATGGATGT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 330
Summary {0: 1, 1: 0, 2: 1, 3: 25, 4: 303}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1174615715_1174615719 -5 Left 1174615715 20:51833935-51833957 CCGACATCCATGAGTTTAAATCC 0: 1
1: 0
2: 1
3: 25
4: 303
Right 1174615719 20:51833953-51833975 AATCCAGGTTGTGTCACCTTGGG 0: 1
1: 1
2: 2
3: 25
4: 200
1174615715_1174615718 -6 Left 1174615715 20:51833935-51833957 CCGACATCCATGAGTTTAAATCC 0: 1
1: 0
2: 1
3: 25
4: 303
Right 1174615718 20:51833952-51833974 AAATCCAGGTTGTGTCACCTTGG 0: 1
1: 0
2: 2
3: 11
4: 197

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1174615715 Original CRISPR GGATTTAAACTCATGGATGT CGG (reversed) Intergenic
901038095 1:6348450-6348472 GGATTTCAACACAGGGATTTTGG - Intronic
904223264 1:28991399-28991421 AGGTTTAAAATCATGGATTTTGG + Intronic
904256406 1:29257628-29257650 GAATTTAGACTCAGGGATGGGGG + Intronic
904438190 1:30512887-30512909 GGATTTGAACTCAGGGCTTTTGG - Intergenic
907514067 1:54982126-54982148 GGATTTGAACTCAGAGATGCTGG + Intronic
907531712 1:55105600-55105622 GTATTTATACTCTTGGAGGTAGG - Intronic
907945375 1:59131300-59131322 GGATTTCAACATATGGATTTGGG - Intergenic
908832143 1:68190189-68190211 GGATTTAAACCCATTGCTGTAGG + Intronic
908869559 1:68593472-68593494 GGATTTAAACATATGAATTTTGG - Intergenic
909134580 1:71782093-71782115 AGATTTTAACTCATGAATTTGGG - Intronic
909536949 1:76747667-76747689 GGTTTAAAACTCATGGGTTTAGG - Intergenic
910732048 1:90408312-90408334 GAATTGACACTCATGAATGTCGG - Intergenic
912242232 1:107923336-107923358 GGATTTCAACTTATGAATTTAGG - Intronic
913967736 1:143391193-143391215 AGATTTGAACTCATGTATTTTGG + Intergenic
914062114 1:144216783-144216805 AGATTTGAACTCATGTATTTTGG + Intergenic
914117036 1:144749571-144749593 AGATTTGAACTCATGTATTTTGG - Intergenic
916598750 1:166272026-166272048 GGATTTCAACACATGAATGGGGG + Intergenic
917908458 1:179613787-179613809 GGATTTCAACTTAGGGATTTGGG + Intronic
918972094 1:191433006-191433028 GCATATAAACTCAGGGCTGTTGG + Intergenic
920148192 1:203881131-203881153 GGATTTAAACCCAGGTATGTTGG - Intergenic
920618083 1:207514370-207514392 GGATTTCAACATATGGATTTGGG - Intronic
921174788 1:212584614-212584636 GCATTTAAACTGATGGATCAAGG - Intronic
922396348 1:225205182-225205204 GAATTTCAACACATGGATTTTGG - Intronic
922541215 1:226421373-226421395 GGATTTCAACTTATGAATTTGGG + Intergenic
923657278 1:235928745-235928767 GGGTTTCATCCCATGGATGTAGG - Intergenic
1064682163 10:17821314-17821336 GGTTTTTAGCTCATGGATCTTGG - Intronic
1065112230 10:22451716-22451738 GGATTTCAACATATGAATGTGGG + Intronic
1065490070 10:26273838-26273860 GGTATTACACTCATGAATGTGGG + Intronic
1065581507 10:27176198-27176220 GGATTTAAATGCTTGAATGTAGG - Intronic
1066306919 10:34154345-34154367 TCATTCAAACTCATGGATGGAGG - Intronic
1066458305 10:35590881-35590903 GGATTTCAACATATGGATTTGGG + Intergenic
1068556589 10:58465376-58465398 GGATCTAAACTCAGTGCTGTTGG - Intergenic
1070383962 10:75907044-75907066 GCATTCAAACTCTTGGACGTAGG + Intronic
1071493193 10:86150661-86150683 GGATTTTAACACATGAATTTTGG - Intronic
1072069081 10:91899271-91899293 AGATTTGAACTCAGGCATGTTGG + Intergenic
1072215783 10:93286118-93286140 GGATTTCAACTTATGAATGGGGG - Intergenic
1072626440 10:97115380-97115402 GGATTTGAAAGCATGGATGTGGG - Intronic
1073071895 10:100799556-100799578 GGATGTGAACTCAGGGATGTCGG - Intronic
1073328334 10:102655417-102655439 GGATTTGAACCCATGCATGCTGG - Intronic
1073674908 10:105634950-105634972 GGCTTTAAATGTATGGATGTTGG + Intergenic
1076906050 10:133361665-133361687 GGATTTCAACCCAGGGATTTGGG + Intergenic
1078472617 11:11603885-11603907 GGATTTCAACATATGGATTTGGG - Intronic
1078906187 11:15690138-15690160 GGATTTAACTTCCTCGATGTAGG + Intergenic
1078922091 11:15840384-15840406 GGATTTAAACCCATGTAGTTTGG + Intergenic
1079538004 11:21539014-21539036 GGATTTTAACTAATGGAAATGGG - Intronic
1082878087 11:58008794-58008816 AGATTAAAACACATGGATTTTGG + Intergenic
1082896876 11:58201162-58201184 GGATTTTAACACATGAATTTTGG + Intergenic
1083844963 11:65326322-65326344 GGATTTAAACCCAGGTCTGTGGG + Intergenic
1085345057 11:75763277-75763299 GGATTTGATGGCATGGATGTAGG - Intronic
1085802063 11:79599895-79599917 GGATTTCAACATATGAATGTTGG - Intergenic
1085955674 11:81391049-81391071 GGCTTTGAACTCAAGAATGTTGG + Intergenic
1086038199 11:82442320-82442342 GTAGTTGTACTCATGGATGTGGG - Intergenic
1086051850 11:82601387-82601409 GGATTTCAACATATGGATTTAGG + Intergenic
1086367777 11:86125402-86125424 GCATTTAAAGTCATGGAACTGGG + Intergenic
1086932057 11:92704438-92704460 GGATTTTAACACATGGATTTTGG - Intronic
1088336787 11:108714161-108714183 GGAGTAAAACTCATGAGTGTGGG + Intronic
1090433372 11:126665428-126665450 GGATTTCAACACATGAATTTTGG - Intronic
1090721477 11:129478468-129478490 GGATTTCAACTTATGAATTTGGG - Intergenic
1093948337 12:25135639-25135661 GGATATAAACTCAGTGCTGTTGG + Intronic
1094443438 12:30504464-30504486 AGATTTAAACACATGAATTTGGG + Intergenic
1094654330 12:32406250-32406272 GCATTTAAATATATGGATGTGGG + Intronic
1095159396 12:38899184-38899206 GGATTTCAACACATGAATTTTGG - Intronic
1095540847 12:43307049-43307071 GGATTTAAACTCATGGTGCCTGG + Intergenic
1095543630 12:43340453-43340475 GGATTGAAACACATGGCAGTTGG - Intergenic
1095675497 12:44912862-44912884 GGATTTAAACCCAGGCAGGTTGG - Intronic
1095933531 12:47652825-47652847 GGATTTCAACATATGGATTTTGG + Intergenic
1096317834 12:50584112-50584134 GCATTTAAAGCCATGGAAGTGGG - Intronic
1097356735 12:58610685-58610707 GGATTTCAACACATAAATGTTGG - Intronic
1099085225 12:78237941-78237963 GGGTTTAAACTAATGGTTGTTGG + Intergenic
1099109314 12:78537633-78537655 GGATTTCAACATATGGATTTTGG + Intergenic
1101553308 12:105783744-105783766 GGATTTAAACATATGAATTTCGG + Intergenic
1101619659 12:106372639-106372661 GCATTTAAAGTTATGGATATTGG - Intronic
1102771773 12:115483696-115483718 GGATGTGAACTCAGGCATGTTGG + Intergenic
1103222149 12:119254870-119254892 GGATTTCAACATATGGATTTGGG + Intergenic
1103484466 12:121273692-121273714 GTATTTATACTCATGGGTGAGGG - Intronic
1103653384 12:122451141-122451163 TTATTTAAACTCATATATGTGGG + Intergenic
1105432235 13:20347202-20347224 GGAGTTAAACTCATCCATGGGGG - Intergenic
1105529729 13:21208546-21208568 GGATTTTAACACACGAATGTTGG - Intergenic
1105639405 13:22246707-22246729 GGATTTCAACACATGAATTTGGG + Intergenic
1106220624 13:27743698-27743720 GGATTTCAACACATGAATTTCGG + Intergenic
1107799384 13:44089995-44090017 GGACTTCAACTCATGGATTTTGG + Intergenic
1108254144 13:48594508-48594530 GGATTTAAACATATGAATTTTGG - Intergenic
1109436707 13:62313111-62313133 GGATTTCAACATATGGATTTTGG - Intergenic
1109708009 13:66124318-66124340 AAATTTAAACTCCTGGATTTTGG - Intergenic
1110437881 13:75495576-75495598 GGACTTTAACTCATGAATTTGGG - Intergenic
1111434480 13:88188786-88188808 GAATTTAAACGCAATGATGTAGG + Intergenic
1112151502 13:96769459-96769481 GGTTTTAAAGTCAGGAATGTGGG - Intronic
1113377632 13:109780558-109780580 GGATTTAAAATTATAGCTGTGGG - Intronic
1113504354 13:110803999-110804021 GGACTTAAACTCACCGTTGTTGG - Intergenic
1115051116 14:29064679-29064701 GGATTTCAACACATGAATGTGGG + Intergenic
1115072229 14:29337627-29337649 GAATTTATATTCATGGAAGTTGG + Intergenic
1116132851 14:40880983-40881005 GGATTTATAGTCAAGGAAGTGGG + Intergenic
1116160516 14:41262172-41262194 GGATTTAAACTCATGCATGCTGG - Intergenic
1116600376 14:46914589-46914611 GTTATTAAACTCATAGATGTAGG - Intronic
1117639806 14:57786050-57786072 GGAAATAAACTCAGGGCTGTTGG + Intronic
1118683002 14:68262520-68262542 AAATTTATATTCATGGATGTGGG + Intronic
1120605473 14:86570757-86570779 GGATATAAACTCAGTGCTGTTGG - Intergenic
1121818522 14:96946487-96946509 GGATTTCAACATATGGATTTTGG + Intergenic
1122437659 14:101710882-101710904 GGATTTCAACACATAAATGTTGG - Intergenic
1122738568 14:103857627-103857649 GGATTTCAACACATGAATTTGGG + Intergenic
1124002331 15:25769798-25769820 GGATTTGAACGCATGAATCTGGG - Intronic
1125243877 15:37611160-37611182 GTTTTTAAACGGATGGATGTAGG - Intergenic
1126689171 15:51274605-51274627 GGATTTAAACTCAAGTCTTTTGG - Intronic
1126905427 15:53359621-53359643 GGATTTCAACTTATGAATTTGGG + Intergenic
1127376420 15:58389136-58389158 GGACTGAAAGTCATGGATGTGGG - Intronic
1127574107 15:60273339-60273361 GGATATAAACTCAGTGCTGTTGG - Intergenic
1128630003 15:69255124-69255146 GGATTTAGCAACATGGATGTTGG + Intronic
1130082817 15:80749400-80749422 GGTTTTAAGCTGGTGGATGTGGG + Intronic
1130517613 15:84638099-84638121 GGAATTCAACTCAAGGCTGTTGG - Intergenic
1130708325 15:86254402-86254424 GGATTTAAACTCATGTAGTCTGG + Intronic
1131342738 15:91617919-91617941 GGATTTAAACATATGAATTTGGG - Intergenic
1131573108 15:93559293-93559315 GAATTGAAACTCAGGGCTGTGGG + Intergenic
1131943705 15:97596345-97596367 AGATTTATACACATGGATGGAGG + Intergenic
1133404488 16:5512141-5512163 GGAGATAAAATGATGGATGTGGG + Intergenic
1134491676 16:14700524-14700546 AGATTTAAACTCATTTCTGTTGG + Intergenic
1134497057 16:14739642-14739664 AGATTTAAACTCATTTCTGTTGG + Intronic
1135458912 16:22624086-22624108 GGATTTAAACTCAGGTATTCTGG + Intergenic
1136488976 16:30592569-30592591 GGATTTCAAGACATGGATTTTGG + Intergenic
1137062600 16:35805226-35805248 GGGAATAAACTCCTGGATGTTGG - Intergenic
1141150716 16:81562871-81562893 GGATTTGAACTCAGGGCTTTTGG + Intronic
1141224836 16:82105080-82105102 GGATTTTGACACATGGATTTAGG - Intergenic
1144063091 17:11600403-11600425 GGATTTAACCTAGTGTATGTGGG + Intronic
1145115618 17:20208480-20208502 TCATTTAAATTCATGGTTGTTGG - Intronic
1146840022 17:36145019-36145041 GGATTTCATCTTATGGATTTGGG + Intergenic
1146949916 17:36898856-36898878 GGATTTAAACACAGGCCTGTTGG + Intergenic
1149003410 17:51779746-51779768 TGATTCAAATTCATGGATTTAGG + Intronic
1151649205 17:75455841-75455863 GTAATTAAACTCATGAATGTGGG + Intronic
1153354668 18:4122019-4122041 GTATTTAAACTCACAGATGCTGG - Intronic
1153415510 18:4841505-4841527 GGATTTCAACTTATGAATATGGG + Intergenic
1153424953 18:4952822-4952844 GGATATAAACTCACTGCTGTTGG + Intergenic
1155581096 18:27307103-27307125 AGAATTGAACTCATGGGTGTTGG + Intergenic
1156055076 18:32992861-32992883 TTAATTAAACTCAAGGATGTTGG + Intronic
1156818852 18:41344934-41344956 AGATTTAAAACCATGGATATAGG + Intergenic
1157186620 18:45546236-45546258 GGATATAAAATCCTGAATGTAGG - Intronic
1157451327 18:47791375-47791397 GGATTTCAACACATGAATTTTGG + Intergenic
1157956185 18:52100097-52100119 GGAATTAAACTCATGGAGGGAGG - Intergenic
1159427524 18:68309404-68309426 GGATTTAAACCTATGAATTTGGG - Intergenic
1159548104 18:69866230-69866252 GGATTTCAACATATGAATGTTGG + Intronic
1162514748 19:11141204-11141226 GGATTTGAACCCATGGTTGTCGG - Intronic
1163225862 19:15960716-15960738 GGATTTCAACATATGGATTTTGG + Intergenic
1164850337 19:31478033-31478055 GGTTTTCAACCCATGAATGTTGG - Intergenic
1166827920 19:45621030-45621052 GGAGTTAAACTCTTGGTTGCTGG + Intronic
1202701523 1_KI270712v1_random:168661-168683 AGATTTGAACTCATGTATTTTGG + Intergenic
925463604 2:4086521-4086543 GGATTTTGACACATGGATTTGGG + Intergenic
926341171 2:11905856-11905878 GGATTTCAACTCATGTTTGTTGG + Intergenic
926582578 2:14647496-14647518 GGATTTCAACATATGGATTTGGG - Intronic
928263570 2:29789744-29789766 GCGTTTAAAATCATTGATGTGGG + Intronic
928472692 2:31589900-31589922 GGATATAAACTCAGTGCTGTTGG + Intergenic
929126098 2:38523931-38523953 GGAGGAAAACGCATGGATGTGGG + Intergenic
929774007 2:44916745-44916767 GAATGTAAACCCATGGATGCAGG - Intergenic
930123767 2:47781002-47781024 GGATTTAAACTCAAGGAAGCTGG - Intronic
930135392 2:47898478-47898500 TGATTTTAGCTCATGGTTGTAGG - Intronic
930279674 2:49355237-49355259 GCATTTAATCTCATGCCTGTAGG - Intergenic
930567407 2:53039153-53039175 GTATTTGAACTCATAAATGTTGG - Intergenic
930785037 2:55263389-55263411 GGATTTGTACTCATGGTTCTAGG + Intronic
933983451 2:87572263-87572285 AGACTTAAACACATGAATGTGGG + Intergenic
934172439 2:89552108-89552130 AGATTTGAACTCATGTATTTTGG + Intergenic
934282752 2:91626460-91626482 AGATTTGAACTCATGTATTTTGG + Intergenic
936310398 2:111378531-111378553 AGACTTAAACACATGAATGTGGG - Intergenic
936406836 2:112212307-112212329 GGATTTCAACACATGAATTTTGG + Exonic
936505094 2:113099414-113099436 GGAAGTAAACTCATTGCTGTTGG - Intergenic
937801185 2:126081963-126081985 GCATTTTCAGTCATGGATGTAGG - Intergenic
938095320 2:128457571-128457593 GGGTTTCAACTCATGAATTTGGG - Intergenic
938603354 2:132865874-132865896 GGATTTAAAGTGCTGCATGTGGG + Intronic
940113857 2:150185853-150185875 GGATTTAAACTCAGGCTTTTTGG - Intergenic
940595758 2:155790551-155790573 GGATTTAAACCCAGGTATTTTGG - Intergenic
942225092 2:173807954-173807976 GGATTTCAACACATGAATTTTGG + Intergenic
943686241 2:190821359-190821381 GGATTTGGACACGTGGATGTGGG - Intergenic
944154626 2:196596417-196596439 GGATTTCAACACATGAATTTGGG - Intergenic
944883915 2:204043506-204043528 GGATTTCAACTCCTGGGTATTGG - Intergenic
945584954 2:211649505-211649527 GGATTTGAACTCTCGGATTTCGG + Intronic
946801594 2:223423162-223423184 GATTTTAAACTCATGTATTTTGG + Intergenic
946977743 2:225172561-225172583 GGATTTCAACATATGGATTTTGG - Intergenic
947449050 2:230188807-230188829 GGATTTAATCCCAGGGATTTAGG - Intronic
1168803249 20:657490-657512 GGATTTCAACATATGAATGTTGG - Intronic
1169635664 20:7689033-7689055 TGATTTAAACACATGGATCCAGG + Intergenic
1170067694 20:12332154-12332176 GGTTTTAAACTCCTGGGTTTAGG - Intergenic
1170722738 20:18898166-18898188 GCATTTAAACACATGGATTTGGG - Intergenic
1170746660 20:19105607-19105629 GGCTTTAACCTGATGGAGGTGGG - Intergenic
1174499232 20:50972110-50972132 GGATTTACATTCATGGATTGTGG - Intergenic
1174615715 20:51833935-51833957 GGATTTAAACTCATGGATGTCGG - Intergenic
1174851921 20:54004076-54004098 GGATTTGAACACATGAATTTTGG - Intronic
1175066528 20:56293768-56293790 GGATTTCAACATATGGATTTTGG - Intergenic
1175159073 20:56994606-56994628 GGATTTGAACTCAGGCCTGTTGG - Intergenic
1179111276 21:38447599-38447621 GAATCTAAACACATAGATGTGGG + Intronic
1179121531 21:38550379-38550401 GGATTTAAACCCATGAATTTTGG - Intronic
1181744437 22:24946007-24946029 TGATTTAAAACTATGGATGTTGG + Intronic
1181823006 22:25490445-25490467 GGATTTGAACTCAGGTCTGTGGG + Intergenic
1182758100 22:32697298-32697320 GGATTTAAACACAAGTCTGTTGG - Intronic
1184417651 22:44361570-44361592 GGATTTCAACACATGAATTTTGG - Intergenic
1185073294 22:48668955-48668977 GGATTTCAACACATGAATCTGGG - Intronic
949146077 3:701417-701439 GGATATAAACTCAGCGCTGTTGG - Intergenic
949410676 3:3760759-3760781 GGTTTTAAGTTCATGGATCTGGG - Intronic
949830827 3:8212406-8212428 GGATTTCAACACATGAATGCTGG + Intergenic
950215818 3:11157875-11157897 AGATTCAAACTCATGTCTGTTGG - Intronic
953152746 3:40340154-40340176 GGATTTCAACACATGAATTTTGG - Intergenic
953747708 3:45587729-45587751 GGATTTTAACATATGAATGTTGG - Intronic
956698313 3:71937205-71937227 GGATTTAACCTGATGAATGCCGG - Intergenic
957373043 3:79320635-79320657 GGATTTCAACATATGAATGTTGG + Intronic
958151517 3:89699527-89699549 GAATCTAAACTCATTGTTGTTGG + Intergenic
958511471 3:95055020-95055042 GGATTTTAACACATGAATTTTGG + Intergenic
959517880 3:107290300-107290322 GGATTTCAACACATGAATTTTGG - Intergenic
959566445 3:107837328-107837350 GGATTTGAACCCAGGCATGTTGG - Intergenic
961931490 3:130538682-130538704 GTAGTTAAACTCATGGATTCTGG - Intergenic
964184745 3:153929388-153929410 TGATTAAACCTCATGGAAGTAGG + Intergenic
967353404 3:188540518-188540540 GTAATTAAAATCATGGATTTTGG + Intronic
967462061 3:189759069-189759091 AGATTTAAACTCAAGTATATTGG - Intronic
967570147 3:191018723-191018745 GGATTTCAACACATGAATTTGGG + Intergenic
967675542 3:192294414-192294436 GGATTTCAACATATGAATGTAGG + Intronic
967887577 3:194343626-194343648 AGATTTGAACTCATGGAATTAGG - Intronic
967989788 3:195122250-195122272 GGATTTCAACACATGAATTTTGG + Intronic
968333959 3:197896810-197896832 GGATTTCAACATATGGATTTGGG + Intronic
971324658 4:25634087-25634109 GGATTTCAACACATGAATTTGGG + Intergenic
971827530 4:31645691-31645713 GGATTTTAACATATGGATTTGGG - Intergenic
972352104 4:38245389-38245411 GGATTTCAACACATGAATTTTGG - Intergenic
974107655 4:57488919-57488941 GCATGTTAACTCATGTATGTTGG + Intergenic
974637425 4:64582798-64582820 GGATTTCAACACAGGGATTTTGG + Intergenic
975320348 4:73003481-73003503 GGATTTCAACACATGAATTTTGG - Intergenic
975635089 4:76440333-76440355 GGATTTGAACTCATGCATTCTGG + Intronic
975718394 4:77227459-77227481 GGATATAAACTCAGTGCTGTTGG - Intronic
976185628 4:82440081-82440103 GTATTTAAAGTCATGGAATTAGG + Intronic
976284494 4:83358164-83358186 GGATTCACACTCAGGGATGTGGG + Intergenic
977432147 4:96943647-96943669 GGAATTAAACTCATGCTAGTGGG + Intergenic
977592706 4:98844220-98844242 ATTTTTAAAATCATGGATGTTGG + Intergenic
979097836 4:116573584-116573606 GTATAGAAACTCTTGGATGTTGG - Intergenic
980310374 4:131121343-131121365 GGATTTAAACTGTTGCATTTTGG - Intergenic
981442578 4:144799628-144799650 GGATATAAACTCAGTGCTGTTGG - Intergenic
982327170 4:154140341-154140363 GGATTTCAACACATGAATTTTGG - Intergenic
982768033 4:159369812-159369834 GGACTTCAACACATGGATTTTGG + Intergenic
983372200 4:166874639-166874661 GTATTTAAACTCACAGTTGTAGG - Intronic
984188576 4:176576985-176577007 GCATTAAAATTTATGGATGTAGG + Intergenic
984420611 4:179516060-179516082 GGATACAAACTCATGGAGATAGG + Intergenic
985818969 5:2147071-2147093 GGATTTCAACACATGGATTTGGG + Intergenic
987868312 5:23575098-23575120 GGATTTAAACATATGGATTTTGG + Intergenic
988025744 5:25686481-25686503 GGATTTAGACACATGAATTTTGG + Intergenic
988345300 5:30029936-30029958 GGATTTAAACTCATAAATTTTGG - Intergenic
988719775 5:33865288-33865310 GGATTTCACCCCAGGGATGTAGG + Intronic
989265584 5:39470047-39470069 GGTTTTAAACTCCAGGATTTTGG - Intergenic
989543777 5:42648404-42648426 GCATGTGAACGCATGGATGTGGG + Intronic
990710991 5:58580245-58580267 GGAATGAAATTCATGGATGGTGG + Intergenic
991622573 5:68560017-68560039 GGATTTCAACATATGAATGTGGG + Intergenic
992107654 5:73463375-73463397 GGATTTTAACACATGAATTTTGG - Intergenic
992938775 5:81740787-81740809 AGATTTAACAACATGGATGTAGG - Intronic
994778192 5:104061857-104061879 GGATATAAACTCAGTGCTGTTGG - Intergenic
995237426 5:109845118-109845140 TCATTTAAACTCATGAAAGTTGG - Intronic
995245251 5:109928026-109928048 GGGTTTTAACTTATGCATGTTGG + Intergenic
996603506 5:125293637-125293659 GGATGTAAACTCCAGGATGCTGG - Intergenic
997332310 5:133073537-133073559 GTATTTAAACACATGCTTGTTGG + Intronic
997668919 5:135654444-135654466 GGATTCAAACTTATGTAAGTGGG + Intergenic
1001450288 5:171819298-171819320 GGATTTAACGTCATGGCTGGGGG - Intergenic
1001787962 5:174430233-174430255 GGATTTGAACTCACAGAAGTTGG - Intergenic
1002094955 5:176825190-176825212 GGATTCGAGCTCATGCATGTCGG - Intronic
1003104686 6:3206320-3206342 GGATTTAAACATATGTATTTCGG - Intergenic
1004271593 6:14200866-14200888 GGATTTCAACCCATGAATTTCGG + Intergenic
1004517740 6:16335022-16335044 GGATAGAAACTCAGGGATATGGG + Intronic
1004588029 6:17021636-17021658 GGTTTGAAACTCATGGATATAGG + Intergenic
1006538078 6:34716332-34716354 GGATTTGAACTCAAGTCTGTCGG - Intergenic
1006992948 6:38230975-38230997 GGATGTAAACTGATGAAAGTAGG + Intronic
1007143272 6:39599091-39599113 GGATTGGAAAACATGGATGTTGG + Intronic
1007277207 6:40683362-40683384 TAATTTAATCTCATGGATTTGGG + Intergenic
1008043284 6:46825404-46825426 GGAGTTAAACTCAGGGATCTTGG - Exonic
1011287215 6:85737938-85737960 GGATTTCAACAAATGGATTTGGG - Intergenic
1011480638 6:87790110-87790132 GGAGTTAAACTACTGGATATAGG - Intergenic
1012965583 6:105669490-105669512 GGATATAAACTTTAGGATGTTGG + Intergenic
1014158733 6:118141732-118141754 GGATTTCAACATATGAATGTTGG + Intronic
1014927524 6:127291328-127291350 GGATTTAAACCCAGGCAGGTTGG + Intronic
1015639337 6:135314151-135314173 GGATTTTAACACATGAATTTGGG - Intronic
1016667817 6:146663539-146663561 GGATTTCAACACATGAATTTTGG + Intronic
1017809752 6:157976456-157976478 GGAGTTCAACACATGGATTTGGG + Intergenic
1020694731 7:11399477-11399499 GAATTTATACTCATCCATGTTGG + Intronic
1024256609 7:47544378-47544400 GGATTTCAACATATGGATTTTGG - Intronic
1024370318 7:48575892-48575914 GGATATGAACCCATGGGTGTAGG - Intronic
1024566551 7:50686109-50686131 GGATTTCAACACATGAATTTTGG - Intronic
1025244734 7:57308668-57308690 GGATTTAACGTCATGGAAGGCGG - Intergenic
1026308188 7:69160725-69160747 GGATTTCAACATATGGATTTGGG - Intergenic
1026584038 7:71641686-71641708 GGATTTGAACACATGAATTTTGG + Intronic
1028152960 7:87396125-87396147 GGATTTCAAGGTATGGATGTTGG + Intronic
1030059582 7:105612173-105612195 GGATTTAAACCCAGGCATTTTGG - Intronic
1030866224 7:114704551-114704573 GGATTTCAACATATGGATTTAGG + Intergenic
1031068972 7:117141199-117141221 AGTTTTAAACTCATGCATATGGG - Intronic
1031523229 7:122792229-122792251 GGATTTCAACACATGAATTTTGG - Intronic
1031581823 7:123485435-123485457 GGATTTCAACATATGGATTTGGG + Intronic
1032740069 7:134729927-134729949 GGATTTATGCTCCTGGATGGTGG + Intergenic
1036564645 8:9928094-9928116 GGATTTTAACTCAGGCCTGTTGG + Intergenic
1038096916 8:24323304-24323326 GGATTTCAACACATGAATTTTGG + Intronic
1038243871 8:25835662-25835684 GGATTTGAACTCATGTCTGGTGG + Intergenic
1038602558 8:28961140-28961162 GGATATAAATTTATGGATGCTGG - Intronic
1038938425 8:32277883-32277905 GGATTTCAAAGCATGGCTGTGGG - Intronic
1039343858 8:36682299-36682321 GGATTTCAACACATGAATTTTGG + Intergenic
1039491409 8:37950418-37950440 GTATTTAAGCTCATGGAAGTAGG - Intergenic
1040840678 8:51781088-51781110 GGATTTTAACACATGAATTTTGG + Intronic
1041198927 8:55430925-55430947 GGATTTCAACACACGAATGTGGG + Intronic
1041620913 8:59968105-59968127 GCATTAAAAATGATGGATGTTGG - Intergenic
1042663430 8:71180343-71180365 GGATCCAAACTCCTTGATGTTGG - Intergenic
1044617158 8:94154477-94154499 GATTTTAAACTCATGGAGGATGG + Intronic
1044803155 8:95977649-95977671 GGACTTAAGCTCATGGATATAGG + Intergenic
1046816609 8:118591291-118591313 GGATTTCAACTAATGTGTGTTGG - Intronic
1047056916 8:121175302-121175324 GGATTTATGCTCATGGGTTTTGG - Intergenic
1047162045 8:122391435-122391457 GGATTTAAAATGGTGGATTTAGG + Intergenic
1048411972 8:134184470-134184492 GGATTTAAACCCAAGCTTGTTGG - Intergenic
1048829232 8:138459871-138459893 GGATTTAAACTGATGCATTCTGG - Intronic
1050017155 9:1246179-1246201 GGATTTAAACATATGAATTTTGG - Intergenic
1050122459 9:2321480-2321502 GGATTGAAACTCAGGGATCAGGG - Intergenic
1050921530 9:11208011-11208033 GGATGTAAATTCCTGAATGTAGG - Intergenic
1052583095 9:30387049-30387071 GGGTTTAAACTTATGAATTTGGG + Intergenic
1054749420 9:68889338-68889360 GGATTTGAACTCAGGATTGTGGG - Intronic
1057522123 9:95768505-95768527 GGATTTCAACACATGAATTTTGG - Intergenic
1060235606 9:121860538-121860560 GGATTTCAACCTATGGATTTGGG - Intronic
1060591769 9:124821342-124821364 GGATTCAAACTGAAGGCTGTTGG - Intergenic
1061422991 9:130482198-130482220 GGGTTCAAACTCATGTATGGTGG + Intronic
1061729487 9:132602515-132602537 GGAATCAAACTCAGGAATGTTGG + Intronic
1186483992 X:9918894-9918916 GGATTTCAACTTATGGATTTGGG + Intronic
1187784160 X:22865947-22865969 GGATTTCAACACATGAATTTAGG - Intergenic
1188517422 X:31002595-31002617 AGATTCTGACTCATGGATGTAGG - Intergenic
1189569736 X:42283801-42283823 GGATTTCAACACATGAATTTTGG - Intergenic
1192905274 X:75544555-75544577 GGATGTAAACTCAGTGCTGTTGG - Intergenic
1193541295 X:82775612-82775634 GGAAATAAACTCAGGGCTGTTGG - Intergenic
1193771505 X:85593198-85593220 GGATATAAACTCAGTGTTGTTGG + Intergenic
1194866560 X:99076014-99076036 CCATTCAAACTAATGGATGTAGG - Intergenic
1195250049 X:103034631-103034653 ATATTTAAATTCATAGATGTAGG - Intergenic
1195918220 X:109956706-109956728 GGATTTAAACATATGAATTTGGG - Intergenic
1196800413 X:119538193-119538215 GGATACAAACACATGGATATAGG + Exonic
1197985279 X:132260084-132260106 GGACTTCAACACATGGATTTTGG - Intergenic
1198174600 X:134142932-134142954 GGATTTTAACACATGAATTTGGG + Intergenic
1198644134 X:138787907-138787929 GGATTTCAACATATGGATTTTGG + Intronic
1198853123 X:140986939-140986961 GGTTTTAGACACATGGAGGTGGG - Intergenic
1199553509 X:149081294-149081316 GGATATAAACTCAGTGCTGTTGG + Intergenic
1199910639 X:152283145-152283167 GGATTTTAACACATGCCTGTGGG + Intronic
1201336846 Y:12890842-12890864 GGCTTTAATTTCATGGATTTTGG + Intergenic
1202043691 Y:20714454-20714476 GGAAACAAACTCAGGGATGTTGG + Intergenic