ID: 1174616008

View in Genome Browser
Species Human (GRCh38)
Location 20:51836002-51836024
Sequence TGTTATATTGGAGGAAAAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1174616008_1174616013 19 Left 1174616008 20:51836002-51836024 CCTGCTTTTCCTCCAATATAACA No data
Right 1174616013 20:51836044-51836066 CCTGTGCACTTGCTGTTCTCCGG No data
1174616008_1174616014 20 Left 1174616008 20:51836002-51836024 CCTGCTTTTCCTCCAATATAACA No data
Right 1174616014 20:51836045-51836067 CTGTGCACTTGCTGTTCTCCGGG No data
1174616008_1174616015 25 Left 1174616008 20:51836002-51836024 CCTGCTTTTCCTCCAATATAACA No data
Right 1174616015 20:51836050-51836072 CACTTGCTGTTCTCCGGGCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1174616008 Original CRISPR TGTTATATTGGAGGAAAAGC AGG (reversed) Intergenic
No off target data available for this crispr