ID: 1174618456

View in Genome Browser
Species Human (GRCh38)
Location 20:51855122-51855144
Sequence GGTTAGGCCTGGAGGGAAGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1174618456_1174618462 -7 Left 1174618456 20:51855122-51855144 CCCACTTCCCTCCAGGCCTAACC No data
Right 1174618462 20:51855138-51855160 CCTAACCCCTCCTTCATTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1174618456 Original CRISPR GGTTAGGCCTGGAGGGAAGT GGG (reversed) Intergenic
No off target data available for this crispr